ID: 997411216

View in Genome Browser
Species Human (GRCh38)
Location 5:133692409-133692431
Sequence CAGCCAGAGGGATCTTCGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997411216_997411221 11 Left 997411216 5:133692409-133692431 CCTCACGAAGATCCCTCTGGCTG No data
Right 997411221 5:133692443-133692465 ATAGTGGCTGTTGTTAAGTAAGG No data
997411216_997411220 -5 Left 997411216 5:133692409-133692431 CCTCACGAAGATCCCTCTGGCTG No data
Right 997411220 5:133692427-133692449 GGCTGTGAAGCATGGCATAGTGG No data
997411216_997411222 30 Left 997411216 5:133692409-133692431 CCTCACGAAGATCCCTCTGGCTG No data
Right 997411222 5:133692462-133692484 AAGGTAAGACACAGTAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997411216 Original CRISPR CAGCCAGAGGGATCTTCGTG AGG (reversed) Intergenic
No off target data available for this crispr