ID: 997413154

View in Genome Browser
Species Human (GRCh38)
Location 5:133705434-133705456
Sequence GGTCCCACCATTCCAGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997413154_997413161 8 Left 997413154 5:133705434-133705456 CCTCCTTCTGGAATGGTGGGACC No data
Right 997413161 5:133705465-133705487 CCTCTGCTCTGGCGTCCACCAGG No data
997413154_997413157 -3 Left 997413154 5:133705434-133705456 CCTCCTTCTGGAATGGTGGGACC No data
Right 997413157 5:133705454-133705476 ACCCTGGCTCTCCTCTGCTCTGG No data
997413154_997413162 20 Left 997413154 5:133705434-133705456 CCTCCTTCTGGAATGGTGGGACC No data
Right 997413162 5:133705477-133705499 CGTCCACCAGGCCTCTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997413154 Original CRISPR GGTCCCACCATTCCAGAAGG AGG (reversed) Intergenic
No off target data available for this crispr