ID: 997413161

View in Genome Browser
Species Human (GRCh38)
Location 5:133705465-133705487
Sequence CCTCTGCTCTGGCGTCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997413154_997413161 8 Left 997413154 5:133705434-133705456 CCTCCTTCTGGAATGGTGGGACC No data
Right 997413161 5:133705465-133705487 CCTCTGCTCTGGCGTCCACCAGG No data
997413148_997413161 25 Left 997413148 5:133705417-133705439 CCTGCAGGCTCCACACACCTCCT No data
Right 997413161 5:133705465-133705487 CCTCTGCTCTGGCGTCCACCAGG No data
997413150_997413161 15 Left 997413150 5:133705427-133705449 CCACACACCTCCTTCTGGAATGG No data
Right 997413161 5:133705465-133705487 CCTCTGCTCTGGCGTCCACCAGG No data
997413155_997413161 5 Left 997413155 5:133705437-133705459 CCTTCTGGAATGGTGGGACCCTG No data
Right 997413161 5:133705465-133705487 CCTCTGCTCTGGCGTCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997413161 Original CRISPR CCTCTGCTCTGGCGTCCACC AGG Intergenic
No off target data available for this crispr