ID: 997413162

View in Genome Browser
Species Human (GRCh38)
Location 5:133705477-133705499
Sequence CGTCCACCAGGCCTCTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997413150_997413162 27 Left 997413150 5:133705427-133705449 CCACACACCTCCTTCTGGAATGG No data
Right 997413162 5:133705477-133705499 CGTCCACCAGGCCTCTGTGCAGG No data
997413158_997413162 -1 Left 997413158 5:133705455-133705477 CCCTGGCTCTCCTCTGCTCTGGC No data
Right 997413162 5:133705477-133705499 CGTCCACCAGGCCTCTGTGCAGG No data
997413155_997413162 17 Left 997413155 5:133705437-133705459 CCTTCTGGAATGGTGGGACCCTG No data
Right 997413162 5:133705477-133705499 CGTCCACCAGGCCTCTGTGCAGG No data
997413154_997413162 20 Left 997413154 5:133705434-133705456 CCTCCTTCTGGAATGGTGGGACC No data
Right 997413162 5:133705477-133705499 CGTCCACCAGGCCTCTGTGCAGG No data
997413159_997413162 -2 Left 997413159 5:133705456-133705478 CCTGGCTCTCCTCTGCTCTGGCG No data
Right 997413162 5:133705477-133705499 CGTCCACCAGGCCTCTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997413162 Original CRISPR CGTCCACCAGGCCTCTGTGC AGG Intergenic
No off target data available for this crispr