ID: 997415768

View in Genome Browser
Species Human (GRCh38)
Location 5:133727453-133727475
Sequence AGGTGTGCCCAGTGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997415768_997415781 22 Left 997415768 5:133727453-133727475 CCATCTTCCCACTGGGCACACCT No data
Right 997415781 5:133727498-133727520 TGGTGTGAGGCTAACTGTAAAGG No data
997415768_997415782 23 Left 997415768 5:133727453-133727475 CCATCTTCCCACTGGGCACACCT No data
Right 997415782 5:133727499-133727521 GGTGTGAGGCTAACTGTAAAGGG No data
997415768_997415774 -5 Left 997415768 5:133727453-133727475 CCATCTTCCCACTGGGCACACCT No data
Right 997415774 5:133727471-133727493 CACCTGGGGACCAGTCACCAAGG No data
997415768_997415777 2 Left 997415768 5:133727453-133727475 CCATCTTCCCACTGGGCACACCT No data
Right 997415777 5:133727478-133727500 GGACCAGTCACCAAGGGCTGTGG No data
997415768_997415775 -4 Left 997415768 5:133727453-133727475 CCATCTTCCCACTGGGCACACCT No data
Right 997415775 5:133727472-133727494 ACCTGGGGACCAGTCACCAAGGG No data
997415768_997415779 9 Left 997415768 5:133727453-133727475 CCATCTTCCCACTGGGCACACCT No data
Right 997415779 5:133727485-133727507 TCACCAAGGGCTGTGGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997415768 Original CRISPR AGGTGTGCCCAGTGGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr