ID: 997417380 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:133739475-133739497 |
Sequence | ATCTGACTCTCCCTCTGATT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
997417380_997417382 | 1 | Left | 997417380 | 5:133739475-133739497 | CCCAATCAGAGGGAGAGTCAGAT | No data | ||
Right | 997417382 | 5:133739499-133739521 | TGAACTTCACCCACCCTGACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
997417380 | Original CRISPR | ATCTGACTCTCCCTCTGATT GGG (reversed) | Intergenic | ||