ID: 997417380

View in Genome Browser
Species Human (GRCh38)
Location 5:133739475-133739497
Sequence ATCTGACTCTCCCTCTGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997417380_997417382 1 Left 997417380 5:133739475-133739497 CCCAATCAGAGGGAGAGTCAGAT No data
Right 997417382 5:133739499-133739521 TGAACTTCACCCACCCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997417380 Original CRISPR ATCTGACTCTCCCTCTGATT GGG (reversed) Intergenic