ID: 997418011

View in Genome Browser
Species Human (GRCh38)
Location 5:133744007-133744029
Sequence TTTCCTAGATGGGCCTCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997418011_997418015 11 Left 997418011 5:133744007-133744029 CCAGCGGAGGCCCATCTAGGAAA No data
Right 997418015 5:133744041-133744063 TGGTGACATCATTCAGTTCCTGG No data
997418011_997418014 -9 Left 997418011 5:133744007-133744029 CCAGCGGAGGCCCATCTAGGAAA No data
Right 997418014 5:133744021-133744043 TCTAGGAAAGAAACTGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997418011 Original CRISPR TTTCCTAGATGGGCCTCCGC TGG (reversed) Intergenic
No off target data available for this crispr