ID: 997418666

View in Genome Browser
Species Human (GRCh38)
Location 5:133749116-133749138
Sequence GCTTCTGTCTGAGCACTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997418666_997418670 5 Left 997418666 5:133749116-133749138 CCAGTTAGTGCTCAGACAGAAGC No data
Right 997418670 5:133749144-133749166 ACTGGGCTTTGAATCCCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997418666 Original CRISPR GCTTCTGTCTGAGCACTAAC TGG (reversed) Intergenic
No off target data available for this crispr