ID: 997419500

View in Genome Browser
Species Human (GRCh38)
Location 5:133754967-133754989
Sequence TTGAAGGAAGGGTGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997419500_997419511 18 Left 997419500 5:133754967-133754989 CCCACTTCCCACCCTTCCTTCAA No data
Right 997419511 5:133755008-133755030 CCTCCTCATTGCCTCCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997419500 Original CRISPR TTGAAGGAAGGGTGGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr