ID: 997419575

View in Genome Browser
Species Human (GRCh38)
Location 5:133755387-133755409
Sequence TCCTGTCTATAGCAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997419575_997419586 23 Left 997419575 5:133755387-133755409 CCCTCCACCTGCTATAGACAGGA No data
Right 997419586 5:133755433-133755455 CAGCTCTCTTGGCTCAGAAATGG No data
997419575_997419582 12 Left 997419575 5:133755387-133755409 CCCTCCACCTGCTATAGACAGGA No data
Right 997419582 5:133755422-133755444 CCTTCCTCCACCAGCTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997419575 Original CRISPR TCCTGTCTATAGCAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr