ID: 997421044

View in Genome Browser
Species Human (GRCh38)
Location 5:133766981-133767003
Sequence GCCTTTCCTTGACCATCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997421044_997421047 -7 Left 997421044 5:133766981-133767003 CCAGGAGATGGTCAAGGAAAGGC No data
Right 997421047 5:133766997-133767019 GAAAGGCAGAGGCTCTGGTGAGG No data
997421044_997421048 5 Left 997421044 5:133766981-133767003 CCAGGAGATGGTCAAGGAAAGGC No data
Right 997421048 5:133767009-133767031 CTCTGGTGAGGAGACAGAGTAGG No data
997421044_997421049 11 Left 997421044 5:133766981-133767003 CCAGGAGATGGTCAAGGAAAGGC No data
Right 997421049 5:133767015-133767037 TGAGGAGACAGAGTAGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997421044 Original CRISPR GCCTTTCCTTGACCATCTCC TGG (reversed) Intergenic
No off target data available for this crispr