ID: 997430093

View in Genome Browser
Species Human (GRCh38)
Location 5:133831652-133831674
Sequence TGCCAGAACCATAAGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997430090_997430093 1 Left 997430090 5:133831628-133831650 CCTTATATCCTCTGATTACTCAG No data
Right 997430093 5:133831652-133831674 TGCCAGAACCATAAGGAAGTAGG No data
997430089_997430093 2 Left 997430089 5:133831627-133831649 CCCTTATATCCTCTGATTACTCA No data
Right 997430093 5:133831652-133831674 TGCCAGAACCATAAGGAAGTAGG No data
997430091_997430093 -7 Left 997430091 5:133831636-133831658 CCTCTGATTACTCAGTTGCCAGA No data
Right 997430093 5:133831652-133831674 TGCCAGAACCATAAGGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997430093 Original CRISPR TGCCAGAACCATAAGGAAGT AGG Intergenic
No off target data available for this crispr