ID: 997432010

View in Genome Browser
Species Human (GRCh38)
Location 5:133847359-133847381
Sequence TGCCCATTGGTGCCCCAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997432010_997432025 28 Left 997432010 5:133847359-133847381 CCCCTTTGGGGCACCAATGGGCA No data
Right 997432025 5:133847410-133847432 ACACACACAGCTCAAGGGCCTGG No data
997432010_997432015 0 Left 997432010 5:133847359-133847381 CCCCTTTGGGGCACCAATGGGCA No data
Right 997432015 5:133847382-133847404 TAGTGCCTGGCCCAGCCTCCAGG No data
997432010_997432016 1 Left 997432010 5:133847359-133847381 CCCCTTTGGGGCACCAATGGGCA No data
Right 997432016 5:133847383-133847405 AGTGCCTGGCCCAGCCTCCAGGG No data
997432010_997432022 22 Left 997432010 5:133847359-133847381 CCCCTTTGGGGCACCAATGGGCA No data
Right 997432022 5:133847404-133847426 GGAGCCACACACACAGCTCAAGG No data
997432010_997432023 23 Left 997432010 5:133847359-133847381 CCCCTTTGGGGCACCAATGGGCA No data
Right 997432023 5:133847405-133847427 GAGCCACACACACAGCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997432010 Original CRISPR TGCCCATTGGTGCCCCAAAG GGG (reversed) Intergenic
No off target data available for this crispr