ID: 997432641

View in Genome Browser
Species Human (GRCh38)
Location 5:133851348-133851370
Sequence CTTTCTCCCATCTTGGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997432641_997432645 8 Left 997432641 5:133851348-133851370 CCAGTCTCCAAGATGGGAGAAAG No data
Right 997432645 5:133851379-133851401 GGTATTGTCAGCTCTGATTAAGG No data
997432641_997432646 14 Left 997432641 5:133851348-133851370 CCAGTCTCCAAGATGGGAGAAAG No data
Right 997432646 5:133851385-133851407 GTCAGCTCTGATTAAGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997432641 Original CRISPR CTTTCTCCCATCTTGGAGAC TGG (reversed) Intergenic
No off target data available for this crispr