ID: 997434072

View in Genome Browser
Species Human (GRCh38)
Location 5:133861584-133861606
Sequence TGCCAAAGCCATGGTGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997434072_997434081 13 Left 997434072 5:133861584-133861606 CCACCCCCACCATGGCTTTGGCA No data
Right 997434081 5:133861620-133861642 ACACAGCACAAAACTAGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997434072 Original CRISPR TGCCAAAGCCATGGTGGGGG TGG (reversed) Intergenic
No off target data available for this crispr