ID: 997434282

View in Genome Browser
Species Human (GRCh38)
Location 5:133863073-133863095
Sequence CAGAAATAGGGGAAGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997434282_997434288 22 Left 997434282 5:133863073-133863095 CCTGCCACCTTCCCCTATTTCTG No data
Right 997434288 5:133863118-133863140 GCTGCTTAACAAACCAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997434282 Original CRISPR CAGAAATAGGGGAAGGTGGC AGG (reversed) Intergenic
No off target data available for this crispr