ID: 997435654

View in Genome Browser
Species Human (GRCh38)
Location 5:133872826-133872848
Sequence GTCTAGACAGAGGTGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997435648_997435654 -6 Left 997435648 5:133872809-133872831 CCTGCTAGAGAACAGCAGTCTAG No data
Right 997435654 5:133872826-133872848 GTCTAGACAGAGGTGGGGCTGGG No data
997435646_997435654 29 Left 997435646 5:133872774-133872796 CCCTGGTTGATGGTGACAAAATT No data
Right 997435654 5:133872826-133872848 GTCTAGACAGAGGTGGGGCTGGG No data
997435647_997435654 28 Left 997435647 5:133872775-133872797 CCTGGTTGATGGTGACAAAATTC No data
Right 997435654 5:133872826-133872848 GTCTAGACAGAGGTGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997435654 Original CRISPR GTCTAGACAGAGGTGGGGCT GGG Intergenic
No off target data available for this crispr