ID: 997436067

View in Genome Browser
Species Human (GRCh38)
Location 5:133876570-133876592
Sequence CAAGGCTCACGTTACCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997436067_997436073 1 Left 997436067 5:133876570-133876592 CCACCTGGGTAACGTGAGCCTTG No data
Right 997436073 5:133876594-133876616 GGTTCCAAGTTCAGAGCCTGTGG No data
997436067_997436077 26 Left 997436067 5:133876570-133876592 CCACCTGGGTAACGTGAGCCTTG No data
Right 997436077 5:133876619-133876641 AGAACAGGTCCTACTGTCAGAGG No data
997436067_997436075 11 Left 997436067 5:133876570-133876592 CCACCTGGGTAACGTGAGCCTTG No data
Right 997436075 5:133876604-133876626 TCAGAGCCTGTGGCAAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997436067 Original CRISPR CAAGGCTCACGTTACCCAGG TGG (reversed) Intergenic