ID: 997436073

View in Genome Browser
Species Human (GRCh38)
Location 5:133876594-133876616
Sequence GGTTCCAAGTTCAGAGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997436067_997436073 1 Left 997436067 5:133876570-133876592 CCACCTGGGTAACGTGAGCCTTG No data
Right 997436073 5:133876594-133876616 GGTTCCAAGTTCAGAGCCTGTGG No data
997436061_997436073 21 Left 997436061 5:133876550-133876572 CCTGCACACCAGCTCCACACCCA No data
Right 997436073 5:133876594-133876616 GGTTCCAAGTTCAGAGCCTGTGG No data
997436066_997436073 2 Left 997436066 5:133876569-133876591 CCCACCTGGGTAACGTGAGCCTT No data
Right 997436073 5:133876594-133876616 GGTTCCAAGTTCAGAGCCTGTGG No data
997436064_997436073 13 Left 997436064 5:133876558-133876580 CCAGCTCCACACCCACCTGGGTA No data
Right 997436073 5:133876594-133876616 GGTTCCAAGTTCAGAGCCTGTGG No data
997436065_997436073 7 Left 997436065 5:133876564-133876586 CCACACCCACCTGGGTAACGTGA No data
Right 997436073 5:133876594-133876616 GGTTCCAAGTTCAGAGCCTGTGG No data
997436070_997436073 -2 Left 997436070 5:133876573-133876595 CCTGGGTAACGTGAGCCTTGGGG No data
Right 997436073 5:133876594-133876616 GGTTCCAAGTTCAGAGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997436073 Original CRISPR GGTTCCAAGTTCAGAGCCTG TGG Intergenic
No off target data available for this crispr