ID: 997436075

View in Genome Browser
Species Human (GRCh38)
Location 5:133876604-133876626
Sequence TCAGAGCCTGTGGCAAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997436064_997436075 23 Left 997436064 5:133876558-133876580 CCAGCTCCACACCCACCTGGGTA No data
Right 997436075 5:133876604-133876626 TCAGAGCCTGTGGCAAGAACAGG No data
997436065_997436075 17 Left 997436065 5:133876564-133876586 CCACACCCACCTGGGTAACGTGA No data
Right 997436075 5:133876604-133876626 TCAGAGCCTGTGGCAAGAACAGG No data
997436067_997436075 11 Left 997436067 5:133876570-133876592 CCACCTGGGTAACGTGAGCCTTG No data
Right 997436075 5:133876604-133876626 TCAGAGCCTGTGGCAAGAACAGG No data
997436066_997436075 12 Left 997436066 5:133876569-133876591 CCCACCTGGGTAACGTGAGCCTT No data
Right 997436075 5:133876604-133876626 TCAGAGCCTGTGGCAAGAACAGG No data
997436072_997436075 -7 Left 997436072 5:133876588-133876610 CCTTGGGGTTCCAAGTTCAGAGC No data
Right 997436075 5:133876604-133876626 TCAGAGCCTGTGGCAAGAACAGG No data
997436070_997436075 8 Left 997436070 5:133876573-133876595 CCTGGGTAACGTGAGCCTTGGGG No data
Right 997436075 5:133876604-133876626 TCAGAGCCTGTGGCAAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997436075 Original CRISPR TCAGAGCCTGTGGCAAGAAC AGG Intergenic
No off target data available for this crispr