ID: 997436077

View in Genome Browser
Species Human (GRCh38)
Location 5:133876619-133876641
Sequence AGAACAGGTCCTACTGTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997436074_997436077 -2 Left 997436074 5:133876598-133876620 CCAAGTTCAGAGCCTGTGGCAAG No data
Right 997436077 5:133876619-133876641 AGAACAGGTCCTACTGTCAGAGG No data
997436072_997436077 8 Left 997436072 5:133876588-133876610 CCTTGGGGTTCCAAGTTCAGAGC No data
Right 997436077 5:133876619-133876641 AGAACAGGTCCTACTGTCAGAGG No data
997436067_997436077 26 Left 997436067 5:133876570-133876592 CCACCTGGGTAACGTGAGCCTTG No data
Right 997436077 5:133876619-133876641 AGAACAGGTCCTACTGTCAGAGG No data
997436070_997436077 23 Left 997436070 5:133876573-133876595 CCTGGGTAACGTGAGCCTTGGGG No data
Right 997436077 5:133876619-133876641 AGAACAGGTCCTACTGTCAGAGG No data
997436066_997436077 27 Left 997436066 5:133876569-133876591 CCCACCTGGGTAACGTGAGCCTT No data
Right 997436077 5:133876619-133876641 AGAACAGGTCCTACTGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997436077 Original CRISPR AGAACAGGTCCTACTGTCAG AGG Intergenic
No off target data available for this crispr