ID: 997437824

View in Genome Browser
Species Human (GRCh38)
Location 5:133887703-133887725
Sequence AGGGACAGTCCAGTGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997437814_997437824 27 Left 997437814 5:133887653-133887675 CCAAAGCCAGCAAAAGAGACATA No data
Right 997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG No data
997437817_997437824 21 Left 997437817 5:133887659-133887681 CCAGCAAAAGAGACATAGGGTTT No data
Right 997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG No data
997437813_997437824 28 Left 997437813 5:133887652-133887674 CCCAAAGCCAGCAAAAGAGACAT No data
Right 997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997437824 Original CRISPR AGGGACAGTCCAGTGACTGT GGG Intergenic
No off target data available for this crispr