ID: 997439304

View in Genome Browser
Species Human (GRCh38)
Location 5:133898145-133898167
Sequence AACACTGATGTCACCAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997439300_997439304 19 Left 997439300 5:133898103-133898125 CCAGAAAAAGGAGCTCGAACTTG No data
Right 997439304 5:133898145-133898167 AACACTGATGTCACCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997439304 Original CRISPR AACACTGATGTCACCAGAGC AGG Intergenic
No off target data available for this crispr