ID: 997439631

View in Genome Browser
Species Human (GRCh38)
Location 5:133900002-133900024
Sequence TTGCATCCGCAGGAGATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997439631_997439637 4 Left 997439631 5:133900002-133900024 CCAGAGATCTCCTGCGGATGCAA No data
Right 997439637 5:133900029-133900051 CGGAGGTCAAAGGCAGGTGCCGG No data
997439631_997439638 5 Left 997439631 5:133900002-133900024 CCAGAGATCTCCTGCGGATGCAA No data
Right 997439638 5:133900030-133900052 GGAGGTCAAAGGCAGGTGCCGGG No data
997439631_997439636 -2 Left 997439631 5:133900002-133900024 CCAGAGATCTCCTGCGGATGCAA No data
Right 997439636 5:133900023-133900045 AAGAGACGGAGGTCAAAGGCAGG No data
997439631_997439639 11 Left 997439631 5:133900002-133900024 CCAGAGATCTCCTGCGGATGCAA No data
Right 997439639 5:133900036-133900058 CAAAGGCAGGTGCCGGGCCATGG No data
997439631_997439635 -6 Left 997439631 5:133900002-133900024 CCAGAGATCTCCTGCGGATGCAA No data
Right 997439635 5:133900019-133900041 ATGCAAGAGACGGAGGTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997439631 Original CRISPR TTGCATCCGCAGGAGATCTC TGG (reversed) Intergenic
No off target data available for this crispr