ID: 997440690

View in Genome Browser
Species Human (GRCh38)
Location 5:133906826-133906848
Sequence GGCTGAGGTCAGAGAGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997440690_997440698 -2 Left 997440690 5:133906826-133906848 CCTTGGCCTCTCTGACCTCAGCC No data
Right 997440698 5:133906847-133906869 CCACAAAGGGGGAAGCATATTGG No data
997440690_997440700 14 Left 997440690 5:133906826-133906848 CCTTGGCCTCTCTGACCTCAGCC No data
Right 997440700 5:133906863-133906885 ATATTGGTGAGGATTAAATGAGG No data
997440690_997440699 3 Left 997440690 5:133906826-133906848 CCTTGGCCTCTCTGACCTCAGCC No data
Right 997440699 5:133906852-133906874 AAGGGGGAAGCATATTGGTGAGG No data
997440690_997440701 28 Left 997440690 5:133906826-133906848 CCTTGGCCTCTCTGACCTCAGCC No data
Right 997440701 5:133906877-133906899 TAAATGAGGTGCTGCACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997440690 Original CRISPR GGCTGAGGTCAGAGAGGCCA AGG (reversed) Intergenic
No off target data available for this crispr