ID: 997440743

View in Genome Browser
Species Human (GRCh38)
Location 5:133907150-133907172
Sequence GTGGGGAGCCTGCCTGCGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997440734_997440743 12 Left 997440734 5:133907115-133907137 CCCCTGAGTCGTAGCTCTGAGCA No data
Right 997440743 5:133907150-133907172 GTGGGGAGCCTGCCTGCGCAGGG No data
997440735_997440743 11 Left 997440735 5:133907116-133907138 CCCTGAGTCGTAGCTCTGAGCAG No data
Right 997440743 5:133907150-133907172 GTGGGGAGCCTGCCTGCGCAGGG No data
997440733_997440743 16 Left 997440733 5:133907111-133907133 CCAGCCCCTGAGTCGTAGCTCTG No data
Right 997440743 5:133907150-133907172 GTGGGGAGCCTGCCTGCGCAGGG No data
997440736_997440743 10 Left 997440736 5:133907117-133907139 CCTGAGTCGTAGCTCTGAGCAGC No data
Right 997440743 5:133907150-133907172 GTGGGGAGCCTGCCTGCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997440743 Original CRISPR GTGGGGAGCCTGCCTGCGCA GGG Intergenic
No off target data available for this crispr