ID: 997447627

View in Genome Browser
Species Human (GRCh38)
Location 5:133952943-133952965
Sequence CAGCTAGTACAGATGGGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997447619_997447627 -2 Left 997447619 5:133952922-133952944 CCCTATGGTGCCCACTGGTACCA No data
Right 997447627 5:133952943-133952965 CAGCTAGTACAGATGGGTCTGGG No data
997447620_997447627 -3 Left 997447620 5:133952923-133952945 CCTATGGTGCCCACTGGTACCAG No data
Right 997447627 5:133952943-133952965 CAGCTAGTACAGATGGGTCTGGG No data
997447615_997447627 15 Left 997447615 5:133952905-133952927 CCAGATGCTGTTTCTGCCCCTAT No data
Right 997447627 5:133952943-133952965 CAGCTAGTACAGATGGGTCTGGG No data
997447618_997447627 -1 Left 997447618 5:133952921-133952943 CCCCTATGGTGCCCACTGGTACC No data
Right 997447627 5:133952943-133952965 CAGCTAGTACAGATGGGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997447627 Original CRISPR CAGCTAGTACAGATGGGTCT GGG Intergenic
No off target data available for this crispr