ID: 997447728

View in Genome Browser
Species Human (GRCh38)
Location 5:133953651-133953673
Sequence GTGCACATCCACAATTCTAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997447728_997447731 2 Left 997447728 5:133953651-133953673 CCCGTAGAATTGTGGATGTGCAC No data
Right 997447731 5:133953676-133953698 AAGGACTGACACGCTGTACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997447728 Original CRISPR GTGCACATCCACAATTCTAC GGG (reversed) Intergenic
No off target data available for this crispr