ID: 997447854

View in Genome Browser
Species Human (GRCh38)
Location 5:133954665-133954687
Sequence ACTGTTTTGCAGGCTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997447854_997447859 20 Left 997447854 5:133954665-133954687 CCCTCCACAGCCTGCAAAACAGT No data
Right 997447859 5:133954708-133954730 CTTTATAAATTATCCAGTCTCGG 0: 249
1: 3857
2: 4542
3: 3237
4: 3445
997447854_997447860 21 Left 997447854 5:133954665-133954687 CCCTCCACAGCCTGCAAAACAGT No data
Right 997447860 5:133954709-133954731 TTTATAAATTATCCAGTCTCGGG 0: 575
1: 7750
2: 14082
3: 14112
4: 10506

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997447854 Original CRISPR ACTGTTTTGCAGGCTGTGGA GGG (reversed) Intergenic
No off target data available for this crispr