ID: 997448797

View in Genome Browser
Species Human (GRCh38)
Location 5:133965038-133965060
Sequence CAGATCATGTAGGATCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 518
Summary {0: 1, 1: 1, 2: 19, 3: 80, 4: 417}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997448797 Original CRISPR CAGATCATGTAGGATCTTGA AGG (reversed) Intronic
902546766 1:17195144-17195166 CAGATCATGAGGGATCAGGATGG + Intergenic
903087286 1:20873138-20873160 CAAATCATGTAGTATCTTTTTGG + Intronic
903690688 1:25171348-25171370 CGGACCATGCAGGATCTTGTAGG - Intergenic
904146870 1:28400047-28400069 CAGGACATGTAGGATCTTATAGG + Intronic
904715220 1:32462860-32462882 CAGATTATGTAGGAATTTGTAGG - Intergenic
905071621 1:35230813-35230835 CAGATCATGAATGGTCTTGAAGG + Intergenic
905546876 1:38807207-38807229 CAGATCAGGAAGGGTCTTGTGGG + Intergenic
905556448 1:38888994-38889016 CAGATTATGTAGGGTCTATATGG + Intronic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
906739083 1:48163472-48163494 GAGATAATGCAGGATATTGAAGG + Intergenic
906824068 1:48959864-48959886 CAGATCATGTAGGGCCTTGTAGG + Intronic
907021249 1:51068599-51068621 CAGATCATGAAGGGTCTTGTGGG - Intergenic
908012391 1:59791990-59792012 CAGATTATGTAAGTTCTAGAAGG + Intergenic
908206529 1:61856032-61856054 CTGATCTTGTAGGATCTAAAGGG - Exonic
909787008 1:79626147-79626169 CAGATCATGTAAGATTCAGACGG + Intergenic
909919259 1:81360092-81360114 TAGATCATGTACAGTCTTGAAGG - Intronic
910309044 1:85802266-85802288 CACATCATGGAGGCTATTGAAGG - Intronic
910322641 1:85965902-85965924 CAGGTCATGTAGGGCCTTGCAGG + Intronic
910624059 1:89287537-89287559 CAGATCGTGTAGAATCTTGCAGG - Intergenic
910626240 1:89311177-89311199 CAGATTGTGTAAGATCTTGCAGG - Intergenic
910902319 1:92134354-92134376 CAGATCATGGAGGGTCTTGCAGG - Intronic
910967293 1:92820281-92820303 CAGAGCATGTAGGATTTTGTGGG + Intergenic
911596301 1:99802124-99802146 AAGATCATGTAGGAACCTGAAGG - Intergenic
911651637 1:100395748-100395770 CAGATCAGAAAGGATCTTAATGG - Intronic
911674088 1:100639157-100639179 CAGATCATCTGAGACCTTGAAGG + Intergenic
912096470 1:106150390-106150412 GAGATCATTTTGGATCTTTAAGG + Intergenic
912884688 1:113458028-113458050 CAGGTCACGTAGGAACTTGTGGG + Intronic
913286902 1:117234880-117234902 TAGATCATGTAGGGCCTTGTGGG + Intergenic
915351060 1:155226474-155226496 CAGATTGTGTAGGGTCTTGGTGG + Intergenic
915923991 1:160002365-160002387 CAGATCCTGCAGGGTCTTGTAGG - Intergenic
916036858 1:160929878-160929900 CAGATTGTGTAGGATATTGTGGG - Intergenic
916366926 1:164039711-164039733 CAAATGATGCAGGATCTTGCAGG - Intergenic
916784163 1:168071786-168071808 TATGTCATGTAGGACCTTGAAGG - Intronic
916984574 1:170176979-170177001 AAGATTATGTAGGATCTTGTAGG + Intergenic
917015684 1:170528980-170529002 GAGATCATGTAGGAACATGCAGG + Intergenic
918180011 1:182079214-182079236 CAGATCACATAGGGTCTTGCAGG + Intergenic
918652580 1:186983906-186983928 TATATCATGTAGGATCAGGATGG + Intronic
919733753 1:200931316-200931338 CAGATCATGAAGGGTCTTGTGGG - Intergenic
919754315 1:201057158-201057180 CAGATCATCTAGGCCCTTGAAGG - Intronic
920036172 1:203067280-203067302 CAGATCATGGAGTATCTTATAGG + Intronic
922429080 1:225529220-225529242 CAGATCATGCAGGACCTTGCAGG - Intronic
923403237 1:233636139-233636161 CAGATCATGTAGGACCTTATGGG + Intronic
923543624 1:234908099-234908121 CAAATAATGCAGGATCTTTATGG + Intergenic
923719578 1:236455428-236455450 CAGATCTTGTTGGAGCTTGAAGG - Intronic
924003283 1:239577789-239577811 CAGACCATGCATTATCTTGAAGG + Intronic
924173995 1:241370917-241370939 CAGATAATTTAGGGTCTTGAAGG - Intergenic
924189375 1:241534053-241534075 CAGATCTTGTAGGATCTTAGAGG + Intronic
924200193 1:241650500-241650522 CAGATCACGTAGGATCTTATTGG - Intronic
924721502 1:246627274-246627296 AAGATCATGTAGGGCCTTGTAGG - Intronic
1065255486 10:23862728-23862750 CAGATCACAGAGGATCTTGTAGG + Intronic
1065412207 10:25442016-25442038 CAGACCATGAAGGAGCTAGAAGG + Intronic
1065715175 10:28559901-28559923 TAGATCATGTAAGGTCTTGCAGG + Intronic
1068482659 10:57613040-57613062 CAGATTAATTTGGATCTTGAAGG + Intergenic
1069401184 10:68048524-68048546 CAGAGCATAGAGGATTTTGAGGG + Intronic
1070849216 10:79550058-79550080 CAGACCATGTGGGACCCTGATGG + Intergenic
1070924636 10:80211032-80211054 CAGACCATGTGGGACCATGATGG - Intergenic
1071013890 10:80971634-80971656 AAGGTCATGTGGTATCTTGATGG + Intergenic
1071910145 10:90222395-90222417 CAGAGCATAGAGGATCTTTAGGG - Intergenic
1071986950 10:91061535-91061557 CAGATCATGGGGGACCTTGTAGG - Intergenic
1072185410 10:93033061-93033083 CAAATCATGTAAGGCCTTGAGGG + Intronic
1075272188 10:121061909-121061931 CAGATCATGGAGGATGGGGAAGG + Intergenic
1076242619 10:128921102-128921124 CATATCATATAGTATCTTTATGG + Intergenic
1076631597 10:131855309-131855331 CAGAACATGAAGGATTTTGGTGG - Intergenic
1078409343 11:11099063-11099085 CTAGTCATGAAGGATCTTGAAGG - Intergenic
1078719427 11:13870957-13870979 CAGACCATGTGAGGTCTTGAAGG + Intergenic
1078846744 11:15125329-15125351 CAGCTCATGAAGGCTCTTGTGGG + Intronic
1079004823 11:16784130-16784152 CAGATCACTTAGGGCCTTGACGG - Intronic
1079281499 11:19090900-19090922 CAGGCCATGAAGGACCTTGAAGG - Intergenic
1079733816 11:23970439-23970461 AAGATCATGTAGGGTCTTCCAGG + Intergenic
1079927716 11:26515915-26515937 CAGATATTGTAGGAACTTCAGGG + Intronic
1080373176 11:31676063-31676085 CAGGTCATGTAGGGTCTTGGTGG - Intronic
1080580369 11:33637445-33637467 CAGATCATGCAGGGTCTTAAAGG - Intronic
1080935856 11:36862672-36862694 CAGATCATATAGGATCTTTTGGG - Intergenic
1081264887 11:41008322-41008344 CAGATAATGTAGGGTTTTGTAGG - Intronic
1081296970 11:41403122-41403144 CAGATAATTGAGGATTTTGAAGG + Intronic
1081729768 11:45362222-45362244 TAGATCATGTAGGGTCTTTTGGG - Intergenic
1081752493 11:45521874-45521896 TTTTTCATGTAGGATCTTGAAGG - Intergenic
1081925050 11:46819387-46819409 CAGATCATGCAGGACTATGAAGG + Intronic
1082130868 11:48487820-48487842 CAGGTCATCTAGGGTCTTGTAGG + Intergenic
1082564367 11:54658693-54658715 CAGGTCATCTAGGGTCTTGTAGG + Intergenic
1082773124 11:57224242-57224264 CAGGTCATGTAGGACCTTGAAGG - Intergenic
1082947927 11:58780170-58780192 GAGATCATTTTGGAACTTGAAGG - Intergenic
1083968257 11:66056462-66056484 CAGATTGTGCTGGATCTTGAGGG + Intronic
1084977538 11:72810860-72810882 CAGATCAAGCAGGGCCTTGAAGG + Intergenic
1085851453 11:80124836-80124858 GAGATTATGTTGGATCTTTAAGG + Intergenic
1086884772 11:92192634-92192656 CAGATCATAAAGGATCTTTTAGG - Intergenic
1086980735 11:93195664-93195686 CAAATTATGTAGGGTCTTGTAGG - Intronic
1087493775 11:98863643-98863665 GAGATCATTTTGGAACTTGAAGG - Intergenic
1087670863 11:101105155-101105177 CAGATGCTGTAGGGCCTTGAAGG + Intronic
1088227397 11:107636324-107636346 CAGATCCTGTAAGATTTTTAAGG - Intronic
1088280055 11:108126432-108126454 CAGATCATGCAGGTTCTTGGAGG + Intronic
1088673685 11:112168971-112168993 CAGATAATACAGGACCTTGAAGG + Intronic
1090944709 11:131419659-131419681 CACATCATGTAGGTGGTTGAAGG + Intronic
1091002343 11:131920552-131920574 CAGATCATGAAAGATCAAGACGG - Intronic
1091203308 11:133799574-133799596 CAGATTTTGAAGGATCTTGAAGG + Intergenic
1091427790 12:406502-406524 CAGATCATACAGGACCTTGTCGG + Intronic
1091461808 12:648731-648753 CAGATCATGATGGACCCTGAAGG - Intronic
1093318657 12:17684275-17684297 CATATCATGTAGTATCATGAAGG - Intergenic
1094055506 12:26265432-26265454 TAGATCATGAAGGACCTTGCAGG + Intronic
1094173140 12:27515321-27515343 CAGATCACTTAGGGTCTTGAAGG - Intergenic
1094342861 12:29432164-29432186 CAGATCCTATAGCATCTTGTAGG + Intronic
1095700504 12:45186220-45186242 CAGATCATGTAGGGCCTTACAGG + Intergenic
1095730446 12:45500971-45500993 CAGATCATTTAGGAACTTCTAGG + Intergenic
1095909270 12:47409372-47409394 CAGATCATGGAGGGCCTGGAAGG - Intergenic
1095926404 12:47583850-47583872 CAGACCATGTAGGGCCTTGGGGG + Intergenic
1096201734 12:49688410-49688432 CAGATTATGTGGGACCTTGTTGG - Intronic
1097682111 12:62658572-62658594 CAAATCATGTAGGATCTTTAGGG + Intronic
1099203363 12:79700875-79700897 CAGATCATACAGGGTCTTAAAGG - Intergenic
1099318679 12:81117621-81117643 CAGATCATATAGAACCTTGCAGG + Intronic
1099496889 12:83359310-83359332 CAGATCATGTAGGATGTTGTAGG + Intergenic
1100164776 12:91904011-91904033 AAGATTATGTATGATCTTCAAGG + Intergenic
1101798769 12:108002320-108002342 CTGATCCTGTAGGACCTTGAGGG - Intergenic
1102819346 12:115894735-115894757 CAGATCCTGTAGAACCTTGGAGG + Intergenic
1103085020 12:118056165-118056187 CAGATTATGCTGGATTTTGAGGG - Intronic
1103215873 12:119201066-119201088 CAGATCATGTGGGACTTTGAAGG - Intronic
1103254616 12:119530348-119530370 TAGATCAAGTAGGTTCTTCAAGG + Intronic
1103255813 12:119540524-119540546 CAAATCTTCCAGGATCTTGAGGG + Intronic
1103387847 12:120547753-120547775 CAGATCATGTGGGGCTTTGAAGG + Intronic
1103761666 12:123254545-123254567 GAGATCATGGAGGATCATGGAGG + Intronic
1103856835 12:123976487-123976509 CAGATCAAGTAGGGTCATGTAGG + Intronic
1104411305 12:128560320-128560342 CAGATCACTCAGGATCTTGCAGG - Intronic
1106167459 13:27261472-27261494 CAGATAATGTAGGGTTTTGTAGG - Intergenic
1106317019 13:28603320-28603342 GAGAACATGGAGGATCTTGCAGG - Intergenic
1106446374 13:29835923-29835945 TAGATCATGCAGGACCCTGAAGG + Intronic
1106929243 13:34646089-34646111 CAGATTATGGAGAACCTTGACGG + Intergenic
1107175219 13:37391953-37391975 CAGATCATGTAGGGCTTTGCAGG + Intergenic
1107438765 13:40405011-40405033 CAGATCATGTAGCATCCTATTGG - Intergenic
1107975423 13:45683828-45683850 GAGGTCATGTAGGGCCTTGAGGG - Intergenic
1108101075 13:46956586-46956608 CAAAGCATGAAGGATCTTTAGGG - Intergenic
1108126939 13:47254853-47254875 CAGATCATGTTGGGCCTTGAAGG + Intergenic
1108994973 13:56718723-56718745 CAGATCATATATGACCTTGTAGG + Intergenic
1109379335 13:61539273-61539295 GAGATTTTGAAGGATCTTGAAGG + Intergenic
1109700742 13:66021587-66021609 CAGATCTTGTAGGTACTTTAAGG - Intergenic
1110064765 13:71089386-71089408 CAGATCATGTAGAACCTGGTGGG + Intergenic
1110145740 13:72188207-72188229 CAGACCATGCAGGGTCTTAAAGG - Intergenic
1110270503 13:73584306-73584328 CATATTATGCAGGATCTTGTAGG + Intergenic
1110332815 13:74292504-74292526 CAGGTCATGTAGATTCTGGAAGG - Intergenic
1110639217 13:77802530-77802552 AAGATCATGTAGGAGCTTGTAGG + Intergenic
1114171536 14:20277784-20277806 AATTTCATGTAGGATATTGAGGG - Intronic
1115122518 14:29954443-29954465 CAGATCAAGTGGGACCTTAATGG - Intronic
1115732666 14:36287994-36288016 CAGATCATGTAGGGCCCTGTAGG + Intergenic
1116024354 14:39497346-39497368 GAGATCATTTTGGATCTTTAAGG + Intergenic
1117085557 14:52196800-52196822 GAGATCATTTTGGAACTTGAAGG + Intergenic
1117344616 14:54820033-54820055 CAGGTCATGAAGGGTCTTGTGGG - Intergenic
1117828730 14:59729288-59729310 CAGATCATGTAGGATCTCATGGG + Intronic
1118587054 14:67363692-67363714 CAGATCATATAGGATTCTGTAGG + Intronic
1119903027 14:78277388-78277410 CAGGTCCTGTATGCTCTTGAGGG + Intronic
1120352549 14:83381335-83381357 GAGATCATGTAGAATGTTGTAGG + Intergenic
1120652158 14:87147737-87147759 CAGAACATGTCAGATCTTAAAGG - Intergenic
1121303211 14:92888387-92888409 AAGATCATGTATGGTCTTCAGGG + Intergenic
1121805929 14:96822832-96822854 GAGATCAAGTAGGGCCTTGAAGG - Intronic
1122440648 14:101729499-101729521 CAGGTCACGTAGGGTCTTGTGGG - Intergenic
1124994598 15:34710736-34710758 CAGCTTATATAGCATCTTGAAGG + Intergenic
1125212321 15:37231827-37231849 GAGATCATGTAGGGTTTTGTAGG + Intergenic
1125428084 15:39569751-39569773 CATATCATGTTGGAACTAGAAGG + Intergenic
1125900629 15:43343337-43343359 CAGATCATGTGGGACCTTGTAGG - Intronic
1126068444 15:44844694-44844716 CTGATTATGGAGGATCTTGAAGG - Intergenic
1126090386 15:45046112-45046134 CTGATTATGGAGGATCTTGAAGG + Intronic
1126268803 15:46788048-46788070 CAGATAAGGTAGGATTTTAAAGG - Intergenic
1127580752 15:60337473-60337495 CAGCTGATGTTGGAGCTTGATGG - Intergenic
1130358684 15:83159852-83159874 CAGATTATTTAGGGCCTTGAAGG + Intronic
1130705333 15:86227838-86227860 CAGATTCTACAGGATCTTGAGGG + Intronic
1131242024 15:90753794-90753816 CAGAAGATGGAGAATCTTGAGGG - Intronic
1131441673 15:92464318-92464340 CTGCTCATGTAGGCTCTTGAGGG - Exonic
1132123151 15:99195593-99195615 CAGAGCATGGAGGATTTTTAGGG + Intronic
1132828304 16:1915777-1915799 CAGCTCATCCAGGCTCTTGAGGG - Intronic
1134036155 16:11032830-11032852 CAGGTCATGAAGGGCCTTGAAGG + Intronic
1134858164 16:17537796-17537818 CAGATCACCTAGGATCATGTAGG - Intergenic
1135199154 16:20421533-20421555 CAGCTTAGGAAGGATCTTGATGG + Intronic
1135219542 16:20602144-20602166 CAGCTTAGGAAGGATCTTGATGG - Intergenic
1135823992 16:25710310-25710332 TATATCCTGGAGGATCTTGAAGG + Intronic
1137358118 16:47786427-47786449 CAGATCATGTGGGGCCTTGCAGG - Intergenic
1138044357 16:53705312-53705334 CAGATCATGCAGGATCTTGTAGG - Intronic
1138369742 16:56517290-56517312 CAGATCATATAGGAACTTGTAGG - Intronic
1138797255 16:59983940-59983962 CAGATCATAAAGGGTCTTGTAGG + Intergenic
1138874389 16:60931529-60931551 GAGATTGTGTAGGACCTTGAAGG + Intergenic
1139608211 16:68035310-68035332 CAGATCATGTAGAGCCTTGTAGG - Intronic
1140979880 16:80097419-80097441 CAGCTCATATAAGATCTTGTAGG - Intergenic
1142501702 17:336713-336735 CAGATCATGGACGGCCTTGAGGG - Intronic
1143092964 17:4460201-4460223 CAGATCATGTAGGATGTTGTGGG + Intronic
1143347701 17:6262136-6262158 CAGATCTTGGAGGGTCTTGTGGG - Intergenic
1144285044 17:13765975-13765997 CAAGTCATGCAGGATCTTGCGGG + Intergenic
1145842042 17:28003400-28003422 CAGATCATGTAGGGCCCTAAAGG + Intergenic
1146507893 17:33421357-33421379 CAGATCATCAAGGATATGGATGG - Intronic
1147505483 17:41012546-41012568 CAGGCCGTGTAGGATTTTGAAGG + Intronic
1147505495 17:41012615-41012637 CAGGCCGTGTAGGATTTTGAAGG + Intronic
1147505505 17:41012677-41012699 CAGGCCGTGTAGGATTTTGAAGG + Intronic
1147620507 17:41863605-41863627 CAGATCCCGTAGGGCCTTGATGG - Intronic
1149451861 17:56755934-56755956 CAAATCATGCAGGAGCTTGGGGG - Intergenic
1150162939 17:62914699-62914721 CTGATCATGTAGAACCCTGAAGG - Intergenic
1151080324 17:71322226-71322248 CAGATCATGTCGAATCTTGAAGG - Intergenic
1155134869 18:22980599-22980621 CAGGTCATGTAGGATCTTCATGG + Intronic
1155442937 18:25880976-25880998 CAGATCATGTAGGGTCTAGAGGG + Intergenic
1155449546 18:25949492-25949514 CAGATCATTAAGTATCTTTATGG - Intergenic
1155564382 18:27117517-27117539 CAGAGCATGGAGGATTTTTAGGG - Intronic
1155794331 18:30015799-30015821 CAGATCAGGTAAGATTTTCAAGG + Intergenic
1155966317 18:32038652-32038674 CAGATCATGTGAGGTCTTGAAGG + Intronic
1156439582 18:37170770-37170792 CAGATCACATAGGCTCTTTATGG + Intronic
1156809684 18:41232408-41232430 CAGATTATGTAGGGCCTTGTGGG - Intergenic
1157737824 18:50066023-50066045 CAGATCCAGTAGGTTCTTGGGGG + Intronic
1157899855 18:51504453-51504475 CAGATCATGTAACATCTTGTGGG + Intergenic
1161624697 19:5319608-5319630 TAGGTCATGTAGGGTCTTGTGGG - Intronic
1162829965 19:13278260-13278282 CAGATCGTGCAGGGGCTTGAGGG - Intronic
1163155306 19:15436963-15436985 CAGCTCCTGCAGGATGTTGATGG + Exonic
1163187124 19:15646766-15646788 CAGAACATGTTGGATCATGTAGG + Intronic
1163221904 19:15927719-15927741 CAGAACATGTTGGACCTTGTAGG - Intronic
1165322674 19:35095980-35096002 CAGATCCTGTAGGGCCTTGTGGG + Intergenic
1165661326 19:37582989-37583011 CAAATCATGTAGGACCTTGTTGG - Intronic
1165736976 19:38183150-38183172 CAGACCATGGAGGGTCTTGAGGG + Intronic
1165946674 19:39447236-39447258 CAAGTCATATAGGATCTTGAAGG + Intronic
1166039839 19:40195157-40195179 CAGATCACATAGGACCTTGGGGG + Intronic
1166563672 19:43750164-43750186 CAAATCATGTAGGACCTGGTAGG - Intronic
1167204765 19:48093583-48093605 CAGATCATATGGGACCCTGAAGG - Intronic
1167325087 19:48819479-48819501 CAGATCAGGCAGGGCCTTGAAGG - Intronic
1167564535 19:50248176-50248198 CAGATCATGCAGGGTCTTAGGGG + Intronic
1168086714 19:54053112-54053134 TAGAGCATCTAGGATCTTGTGGG - Intronic
925676318 2:6365669-6365691 CAGACCAAGTAAGATCTTGATGG + Intergenic
926876187 2:17482181-17482203 CGGATAATATAGGATCATGATGG + Intergenic
927601805 2:24449298-24449320 CAGATCATGTAGATCCTTGTAGG - Intergenic
928467748 2:31538609-31538631 CAGATTGTCTAGGGTCTTGAAGG - Intronic
929642355 2:43594631-43594653 CAGATTATTTAGGGCCTTGAAGG - Intronic
929982254 2:46692464-46692486 CAGATCATGCAGAACTTTGAAGG - Intergenic
930007254 2:46907946-46907968 CATATCATGGAGCATCTAGAAGG - Exonic
930230195 2:48835410-48835432 GAGATCATTTTGGAACTTGAAGG + Intergenic
930282340 2:49385436-49385458 TAGATCATATAGGATCTTGAGGG - Intergenic
931065191 2:58578264-58578286 CAGATCATGCTGGACCTTGTGGG + Intergenic
931361292 2:61580023-61580045 CAGAACATTTAGGCCCTTGAGGG + Intergenic
931964712 2:67520476-67520498 CAGATCATGTACAATAGTGAAGG + Intergenic
932066112 2:68562778-68562800 GAGATTATGAAGGACCTTGAAGG + Intronic
932633919 2:73371316-73371338 CAGATCATGTAGGCTCCTGTAGG + Intergenic
932760893 2:74438589-74438611 CAGATCATGCAGGGCCTTGAAGG - Intronic
932923784 2:75946598-75946620 CAGAGCATGTAGGATTTTTAGGG - Intergenic
933445792 2:82378153-82378175 GAGATCATTTTGGAACTTGAAGG + Intergenic
933476767 2:82801805-82801827 CAGATTTTTTAGTATCTTGAGGG - Intergenic
933583810 2:84158470-84158492 CAGATCATGTAGGTCACTGAAGG + Intergenic
935915159 2:107941886-107941908 AACATCAAGTAGAATCTTGAGGG - Intergenic
936753778 2:115678880-115678902 CAGATCATTTTGGAACTTTAAGG + Intronic
937940791 2:127284321-127284343 CAGGTCTTGTAGGACCTTGTAGG - Intronic
939097712 2:137853680-137853702 CAAATCATATAGGATCCTGGAGG + Intergenic
939098005 2:137857978-137858000 CAAATCATATAGGATCCTGGAGG - Intergenic
939516704 2:143177735-143177757 CATGTCATGTAGGCTCTGGAAGG - Intronic
940415683 2:153417298-153417320 CAGATGATGTAGGGCCTTGCAGG + Intergenic
940736042 2:157453633-157453655 TAGAACATGCAGGACCTTGAAGG - Intronic
942177710 2:173350471-173350493 CAGATCATGTGGGACCTTCTTGG - Intergenic
942428134 2:175880757-175880779 TAGATCATGCAGGACCTTCACGG + Intergenic
942786179 2:179705436-179705458 GAAATCATGTAGGATACTGATGG - Intronic
943049431 2:182897181-182897203 TAGATCATGTAGAGTCTTGTGGG - Intergenic
944034639 2:195279349-195279371 CAGGTCATATAAGATTTTGAAGG + Intergenic
944219362 2:197286960-197286982 CAGAGCATGCAGGATTTTCAGGG + Intronic
944325777 2:198401825-198401847 CAGATCATGCAGGACCTTGTAGG - Intronic
944395529 2:199262213-199262235 CAGATCATGTAGGGCCTTGCAGG + Intergenic
944668573 2:201976528-201976550 AAGCTCATGTAGGACCTTGTAGG + Intergenic
945697169 2:213121510-213121532 CAGATCATGTATGATATTCCTGG + Intronic
946460688 2:219865894-219865916 TAGATCTTGCAGGACCTTGAAGG - Intergenic
947034496 2:225836592-225836614 CAGACCATGTAAGTTCTTGGAGG - Intergenic
948086216 2:235250967-235250989 CAGAGCATGCAGGATTTTTAAGG + Intergenic
948202820 2:236142203-236142225 CAGATCACGTAGGACCTTGCAGG - Intergenic
1169477469 20:5945229-5945251 CAGATCATTTATGACCTTGCAGG - Intronic
1169834781 20:9865959-9865981 CAGACCATGTAAAATCTTGCAGG + Intergenic
1170243072 20:14191837-14191859 CAGATCATATAGGGTCTTTTAGG + Intronic
1170301539 20:14889730-14889752 CAGATTATGTAGGGCCTTGGAGG + Intronic
1172294277 20:33797378-33797400 GACATCATGTAGGGACTTGAGGG + Intergenic
1172388890 20:34552788-34552810 CAGATTCTGGAGAATCTTGAAGG + Intronic
1172436518 20:34932436-34932458 CAGCTCCTGAAGGATCTTGAAGG - Intronic
1173029075 20:39337940-39337962 CAGATCATGGAGGACCTTCCAGG - Intergenic
1173749401 20:45465037-45465059 AAGATCATGAAGGACCCTGAAGG - Intergenic
1173776607 20:45713987-45714009 CTGCTCATGTAGGCTCATGAGGG - Intergenic
1173916722 20:46713546-46713568 CAGATCCTGCAGAGTCTTGAAGG + Intronic
1174003209 20:47389868-47389890 AAGATCATGGAGGAACTTGGAGG - Intergenic
1174277371 20:49413752-49413774 CAGATCAGACAGGGTCTTGAAGG - Intronic
1174466715 20:50723489-50723511 CAGATCATGCAGCCTCTTGCAGG - Intergenic
1175680576 20:60985467-60985489 CAGTATATGGAGGATCTTGAAGG - Intergenic
1176883829 21:14230178-14230200 CAGATCATTTTGGAACTTTAAGG + Intergenic
1176958184 21:15129999-15130021 TAGATCATGCAGGATCTTGAAGG + Intergenic
1177101522 21:16902800-16902822 AAGATCCAGTAGGATCTGGAGGG + Intergenic
1177529096 21:22337308-22337330 GAGATCATGTTGGAACTTTAAGG + Intergenic
1177922371 21:27168712-27168734 CAGATCATATAGTACCTTGTGGG - Intergenic
1178455153 21:32742323-32742345 CAGATGATAGAGGATCTTGTAGG - Intronic
1178681924 21:34679757-34679779 GAGATCATTTTGGAACTTGAAGG - Intronic
1178942419 21:36917163-36917185 CAGATCATGTAGGAGCTGGCAGG - Intronic
1180012325 21:45059136-45059158 AAGATCATGGAGGATTTTGCAGG + Intergenic
1181888521 22:26040848-26040870 CAGATGATGTAGGGCCTTGTAGG + Intergenic
1182001937 22:26926830-26926852 CAGATTGTGCAGGATCTTGCAGG + Intergenic
1182190381 22:28453908-28453930 TAGATCATGTATGACCTTGTAGG - Intronic
1182620410 22:31615549-31615571 CAGATCACGTAGGGTCCTGCAGG + Intronic
1182819359 22:33201728-33201750 CAGATCCTGTTGGGTCTTGTAGG + Intronic
1182928876 22:34154051-34154073 TGTATCATGTAGGATCTTGTGGG + Intergenic
1184637801 22:45848971-45848993 CAGATCATGCAGGGTCTTCAAGG + Intergenic
1185209543 22:49562363-49562385 CAACTCTTGTAGGATGTTGAGGG - Intronic
950617954 3:14177607-14177629 CAAAACATGTAGTATCTTGTAGG + Intronic
951738572 3:25895462-25895484 TGGATCATGTAGGACCTTGTAGG - Intergenic
952589421 3:34932709-34932731 GAGATCATTTTGGATCTTTAAGG + Intergenic
952598786 3:35053112-35053134 CAGATCAAGTAGAGTCTTGAGGG - Intergenic
953839130 3:46374691-46374713 TAGATCATGAAGAACCTTGACGG + Exonic
954055013 3:48015497-48015519 GAGATCATTTATAATCTTGATGG + Intronic
954312339 3:49779603-49779625 CAGATGATGTCGTATGTTGATGG - Intronic
955075163 3:55606847-55606869 CAGGTAATGTTGGATCTCGAAGG + Intronic
955243863 3:57205463-57205485 CAGGTCATGTAGGGTCCTGCAGG - Intronic
955521654 3:59781105-59781127 AAAGGCATGTAGGATCTTGAAGG + Intronic
955765840 3:62343218-62343240 CAGGTCATGTAGGATTTTCTAGG - Intergenic
956499292 3:69864695-69864717 CAGACCATGAAGGATCTGGTAGG - Intronic
958152726 3:89711995-89712017 CAGATTATGTAGGATATTATAGG - Intergenic
959208945 3:103351063-103351085 CAGATCATGTAGGATCTTTTAGG + Intergenic
959216480 3:103456432-103456454 CAGATAACGTAGGGTCTTGTAGG + Intergenic
959689431 3:109182632-109182654 CAGATCATGCAGGGCCTTGAAGG - Intergenic
959830041 3:110850230-110850252 CAGAGCATGTAGTGTCTTGCAGG + Intergenic
960486954 3:118264949-118264971 CAGATCATGTAGGGCCTTTCAGG + Intergenic
961751940 3:129101745-129101767 CAGAGCATATAGGATCTTGCAGG + Intronic
962166162 3:133050632-133050654 CAGAGCATGAAGGATTTTTAGGG - Intronic
964193720 3:154036694-154036716 CAGATCAAGTAGTATCTTACAGG + Intergenic
965809985 3:172581531-172581553 CAGAACATGGAGGATATTTAGGG - Intergenic
965824264 3:172714707-172714729 CAGATCATTTAGGACCATGTAGG + Intergenic
966045206 3:175540436-175540458 CAGATTTTGTAGGACCTTGGAGG + Intronic
966160495 3:176962491-176962513 CAGGTCATGCAGGACCTTGCAGG + Intergenic
966351327 3:179035229-179035251 CAGATCATGTAGGGCCTTATAGG - Intronic
966809023 3:183827117-183827139 CAGACCATGGAGGGTCTTGGTGG + Intergenic
967382493 3:188874663-188874685 TGAATCATGTAGGATCTTGATGG + Exonic
967866413 3:194193680-194193702 CAGGTCATGAAGGACCTAGACGG + Intergenic
970498984 4:16657569-16657591 CAGATAATGTAGGGCCTTGTAGG - Intronic
970825338 4:20266358-20266380 CACATCATCAAGGATGTTGATGG + Intronic
970854689 4:20638183-20638205 CAGAGACTGCAGGATCTTGAAGG - Intergenic
971404058 4:26304107-26304129 CAAATCATGAAAGATCTTGTGGG - Intronic
972088343 4:35248873-35248895 CAAAACATGTAGCATCTTAAAGG + Intergenic
972312397 4:37892997-37893019 CAGATCTTCTAGGATCTTCTAGG + Intronic
974010092 4:56598733-56598755 CAGATCATGTAGGGCCTTGTAGG + Intronic
974184202 4:58425303-58425325 AAGTTCATGTAGGAACTTGGAGG - Intergenic
974719540 4:65719709-65719731 CAGAACATGAAGTATCTTGCAGG + Intergenic
975294004 4:72711317-72711339 CTGATCATTTAGGATCTCCAGGG - Intergenic
975621918 4:76305174-76305196 CAGATCCTGTAGGGTCTTAAAGG + Intronic
975854451 4:78608409-78608431 CAGATCATGCAGGACCTTTTTGG + Intronic
976403236 4:84632271-84632293 CAGAGCATGTATTATCTTGGTGG + Intronic
976561215 4:86503792-86503814 CATATTATATAGGATCTTGCAGG - Intronic
978537167 4:109774583-109774605 CAGATCTTGTAGGAACCTGTTGG + Intronic
979313311 4:119229881-119229903 CAGATCATGGCTGGTCTTGAAGG - Intronic
979483026 4:121239957-121239979 AAGAGCATGTAGAATCTTGAAGG + Intergenic
980091441 4:128447306-128447328 CAGATCATGTTGGACCTTCTAGG + Intergenic
980191478 4:129530344-129530366 CAGAGCATGTAGGATTTGCATGG - Intergenic
981610323 4:146587157-146587179 CAGATCATATAGGATCTTAAAGG - Intergenic
981702296 4:147619934-147619956 CAGATCATGTTGGACCTTGATGG - Intronic
981721695 4:147808417-147808439 CAGATCATGCAGGGTCTTTCAGG + Intronic
982025801 4:151253140-151253162 CAAATGATGTAGGCTCTTGCAGG - Intronic
982488760 4:156001814-156001836 CAGACAATGTAAGTTCTTGAAGG + Intergenic
983006456 4:162490834-162490856 AAGATCATGTGGGAACTTTAAGG + Intergenic
983437472 4:167733244-167733266 CAGAACATCTATGACCTTGAAGG + Intergenic
984090329 4:175365697-175365719 TAGATAATGTAAGAACTTGATGG + Intergenic
984677536 4:182567494-182567516 CAGGTCATGTAGAATCTGGAAGG - Intronic
984823268 4:183903187-183903209 CAGATCATGCCGGAACTTGCAGG - Intronic
986166298 5:5274332-5274354 CAGAGCATGGAGGATCTGCAGGG - Intronic
987150211 5:15031204-15031226 CAGACTATGGAGGACCTTGAAGG - Intergenic
987246943 5:16058749-16058771 TAGATCACGTAGGACCTTGTGGG + Intergenic
987292556 5:16522417-16522439 CAAATGATGTAGCAACTTGAAGG + Intronic
987748133 5:22004415-22004437 CAGAAAGTGTAGGAACTTGAAGG - Intronic
988168703 5:27627532-27627554 CAGACATTGTAGGACCTTGAAGG - Intergenic
989224628 5:39011682-39011704 GAGATCATTTTGGAACTTGAAGG + Intronic
991515149 5:67427034-67427056 CAGATCTTGTAGGGCCTTGAAGG - Intergenic
991768307 5:70014201-70014223 CAGAAAGTGTAGGAACTTGAAGG - Intergenic
991847545 5:70889283-70889305 CAGAAAGTGTAGGAACTTGAAGG - Intergenic
992238135 5:74733640-74733662 CATATCATGTAAGGTCTTGTAGG + Intronic
992763148 5:79969652-79969674 CAGACCAGGTAGGAGCTTGAAGG - Intergenic
992816812 5:80449623-80449645 CAGATCATTTTGCTTCTTGAAGG + Exonic
992969413 5:82040831-82040853 CAGATCATCTAGGGACTTGTTGG - Intronic
994267234 5:97732432-97732454 CAGATTATGTAGATACTTGAAGG + Intergenic
994992070 5:107009526-107009548 CAGATCATATAGGGTTTTGTAGG + Intergenic
995092585 5:108195507-108195529 CAGATCACATAGGGTCTTGTGGG + Intronic
995227490 5:109717977-109717999 CACTTAATGTAGGATCTAGATGG + Intronic
997448797 5:133965038-133965060 CAGATCATGTAGGATCTTGAAGG - Intronic
997624001 5:135319406-135319428 CTGATCATGTTGGGTCTTGTGGG + Intronic
997636542 5:135411213-135411235 GGGATCATGAAGGATCTTGTTGG + Intergenic
997898992 5:137746369-137746391 CAGATCATGTAGGGATTTGTAGG - Intergenic
997958890 5:138303413-138303435 CAGATCGTGTAGGGCCTTGTAGG - Intronic
998391804 5:141791932-141791954 CAGCTAGTGTAGGGTCTTGATGG + Intergenic
998692627 5:144604021-144604043 CAGATCAAGTAGGACCTTGCAGG + Intergenic
998895334 5:146792839-146792861 CAGATGATGTAGGGTCTTGCAGG + Intronic
999559162 5:152781166-152781188 CAGATCATGTAGGGCCTTGCAGG - Intergenic
999861393 5:155650687-155650709 CAGATCATGTAAGAACTTGTGGG + Intergenic
1000808893 5:165835896-165835918 AAGATCTTGTAGGGTCTTGTAGG + Intergenic
1001349556 5:170945963-170945985 AAGATACTGTTGGATCTTGAAGG + Intronic
1001665957 5:173433943-173433965 CAGATCAGGTCAGATGTTGATGG + Intergenic
1001836511 5:174837069-174837091 GAGATCATTTTGGAACTTGAAGG + Intergenic
1003654825 6:7996875-7996897 CTAATTATGTAGGACCTTGAAGG - Intronic
1004817642 6:19329946-19329968 CAGATCATATAGGGTCCTGTAGG + Intergenic
1006692266 6:35899242-35899264 CAGATCACGTAAGGTCTTGTAGG - Intronic
1006786613 6:36672039-36672061 CAGATCATTTAGGGACTAGAAGG - Intergenic
1006871376 6:37255282-37255304 CAAGTCATGTAGGGTCTTTAAGG + Intronic
1007707614 6:43800355-43800377 GGAATCATGTAGGACCTTGAAGG - Intergenic
1008145378 6:47885461-47885483 AAGATCATGAAGGTTCTTCATGG + Intronic
1008775764 6:55035719-55035741 CAGATCATGTAGGACCCCGTAGG - Intergenic
1008830059 6:55747932-55747954 CAGGTTGTATAGGATCTTGAAGG - Intergenic
1008875418 6:56320495-56320517 CAGATTGTGTAGGACCTTGGGGG - Intronic
1009581400 6:65538787-65538809 CAGATCATGTAGGGTTTGTAAGG - Intronic
1010611348 6:77957516-77957538 CAAATCATGTAGGATTTGGCAGG + Intergenic
1011406251 6:87018280-87018302 GAGATGAAGTAGGAGCTTGATGG - Intergenic
1012188126 6:96247298-96247320 CAGATCATGTAGGACTTTGTAGG + Intergenic
1012547188 6:100433234-100433256 CAGATCGCCTTGGATCTTGAAGG - Intronic
1012698066 6:102415311-102415333 CAGATTATGTAGGATTTTCTAGG + Intergenic
1012783456 6:103592231-103592253 CAGATCATGTATGGCCTTGTAGG - Intergenic
1012969422 6:105711714-105711736 CAGAGCATGTAAGACCTTGCAGG - Intergenic
1013439512 6:110148605-110148627 CAGATTAGGTAGGACCTTGAAGG + Intronic
1014198848 6:118587043-118587065 CAGATATTGTAGGAGCTAGATGG - Intronic
1015228636 6:130887519-130887541 CAGATCATGCAGGGCCTTGGAGG - Intronic
1015255849 6:131178842-131178864 CAGAACATGGAGGATATTGTGGG - Intronic
1015359821 6:132327022-132327044 CAGACCATCTAAGATCTTGTAGG - Intronic
1015713052 6:136162849-136162871 GAGATCATTTTGGAACTTGAAGG - Intronic
1015940921 6:138451107-138451129 TAGATCATGTAGGGTCTTGGAGG - Intronic
1016492007 6:144615898-144615920 CTGATCATGTAGGACCTGGTAGG - Intronic
1016699993 6:147043531-147043553 CAGATCACATAGGATCTTGGAGG - Intergenic
1017365169 6:153627497-153627519 CAGATTATGAAGGGTCTTGTAGG + Intergenic
1020524060 7:9235835-9235857 CAGATCATGCAGCAACTTGTTGG + Intergenic
1020759402 7:12249662-12249684 GAGAGCATGAAGGATCTTGTGGG + Intergenic
1021292744 7:18866085-18866107 CAGTTCATGTAGCATCTCGTAGG - Intronic
1022656950 7:32328446-32328468 CAGATCATGCAGGGACTTGGAGG - Intergenic
1022893645 7:34726879-34726901 CAGAGCATGGAGGATTTTTAGGG + Intronic
1026241768 7:68581716-68581738 CAGATCATGTAGGGTCTTGTAGG - Intergenic
1026375526 7:69746721-69746743 CAGGTCATATAGGACCTTGTAGG + Intronic
1028029394 7:85890683-85890705 CAGATCATCAAGAATCTTAAGGG + Intergenic
1030487526 7:110189091-110189113 CAGATCATGCAGGACTTTGTAGG + Intergenic
1030978797 7:116161912-116161934 CAAACCATGTAGGTACTTGAGGG + Intergenic
1031417965 7:121516084-121516106 CAGATCTTGTAGGATCTTGAAGG - Intergenic
1031584522 7:123518464-123518486 TAGATCATTTAGGACCTTGAAGG - Intronic
1032140644 7:129326854-129326876 TGGATCATGTAGGACCCTGAGGG + Intronic
1033133732 7:138767767-138767789 CAGATCATGGAGGACCCTGGGGG - Intronic
1033432753 7:141304221-141304243 CAGAGCATGTAAGATCTTTCAGG - Intronic
1034168339 7:149042990-149043012 CAGTTCATGTGTGATTTTGACGG - Intergenic
1034725501 7:153331828-153331850 CACATCATGTTGGGTCTTTAGGG + Intergenic
1036227659 8:6973418-6973440 CAGATCATGCCGGTTCATGAAGG - Intergenic
1036230113 8:6992577-6992599 CAGATCATGCTGGTTCATGAAGG - Intergenic
1036232565 8:7011680-7011702 CAGATCATGCTGGTTCATGAAGG - Intronic
1036505280 8:9349238-9349260 CAGATCATGCAGGGTCTTATCGG - Intergenic
1036598534 8:10238051-10238073 CAGATAGTGTAGGACCTTGTGGG - Intronic
1038887720 8:31683559-31683581 CAGAGCATGTAGGATCTTCAGGG + Intronic
1039955271 8:42202517-42202539 CAGCTCATGTGGGTGCTTGAGGG - Intronic
1042165665 8:65943436-65943458 AAGACCAAGTAGAATCTTGAGGG - Intergenic
1042685441 8:71433774-71433796 CAGATCATTCAGCATCCTGAAGG + Intronic
1042737306 8:72004047-72004069 CAGATCAGGCAGAATCCTGACGG + Intronic
1042798944 8:72696567-72696589 CAAATCAGGTAGGATTTGGATGG + Intronic
1043168335 8:76932835-76932857 TAGTTCATGTAGGGTCTCGAAGG - Intergenic
1043207906 8:77470867-77470889 AAGATCAGGTAGGACCTTGAAGG + Intergenic
1043325125 8:79040735-79040757 CAGATCATGCATTAACTTGAAGG + Intergenic
1043551192 8:81374953-81374975 CAGATCCTGTAGGACTTTGTGGG + Intergenic
1043765822 8:84131020-84131042 CAGATCATATAACATTTTGAAGG - Intergenic
1043877610 8:85503785-85503807 CAGATCATGTAAGGCCTTGGGGG - Intergenic
1043939445 8:86180442-86180464 CAGTTCATCTAGGATGTAGAAGG - Intergenic
1045494805 8:102699352-102699374 CAGATCATATAGGATGTTTGGGG + Intergenic
1046078284 8:109338064-109338086 CAGATCATGAAGGATCATGTAGG + Intronic
1046360343 8:113145200-113145222 CAGACCATGTAGAAATTTGAAGG + Intronic
1046814417 8:118568383-118568405 CAGATCATGCAGGATCTGGTAGG + Intronic
1046930352 8:119835901-119835923 TAGATCACGTAGAACCTTGAAGG + Intronic
1047285027 8:123480345-123480367 CAGATCATGCAGGGTCTTTGTGG + Intergenic
1048334815 8:133494639-133494661 CAGTTCATGTAGGATCTTGCAGG - Intronic
1048445349 8:134489068-134489090 CAGATCATGAAGGATCTTATAGG + Intronic
1048742483 8:137577182-137577204 AAGATCAAGTATGATTTTGATGG + Intergenic
1050412931 9:5385061-5385083 CAGATCATGTGGGACCTTCCAGG + Intronic
1051557279 9:18398705-18398727 CAGATCTGGTAGGATCTTATAGG + Intergenic
1051564829 9:18485759-18485781 CAGATCATGCAGGGTGTTGCAGG + Intronic
1053095868 9:35327816-35327838 CAGCTCATGTAGCATCCTGATGG + Intronic
1054861835 9:69961793-69961815 CAGATCATGATGGATCTTGCAGG + Intergenic
1055434240 9:76276449-76276471 AAGATCATATAGGATCTTATAGG - Intronic
1055763542 9:79636382-79636404 CAGCTCATGAAGAATCTTGTAGG - Intronic
1055926607 9:81516741-81516763 CAGATCTTATAGGATGTGGAAGG + Intergenic
1056289274 9:85126387-85126409 CAGGTCATGCAGGATCTTCTGGG + Intergenic
1057030270 9:91769763-91769785 CAGATCATGAAGGTACTGGAGGG - Intronic
1058547251 9:106073758-106073780 CAGATCATGGATGATCTTGAGGG - Intergenic
1058662606 9:107280770-107280792 CAGATCATGTGGGCTCTCCAAGG + Intergenic
1058934184 9:109752648-109752670 CATATTATGAAGGACCTTGAAGG + Intronic
1059268112 9:113055026-113055048 CAGATAATGTAGGATTTTATTGG - Intronic
1059348245 9:113646795-113646817 CAGATCACGCAGGGCCTTGAAGG - Intergenic
1059917027 9:119115332-119115354 CAGATCATGAAGAACCTTCATGG - Intergenic
1060064134 9:120487998-120488020 CATATCATGTGTGATCATGAAGG - Intronic
1060463655 9:123882931-123882953 CAGATCATGTAGGACTTTGTAGG - Intronic
1186341040 X:8646382-8646404 CAGATAAAGTAGGATTTTGTGGG + Intronic
1186400843 X:9258050-9258072 CACATCATTTGGGATCTTGCAGG + Intergenic
1186592392 X:10944570-10944592 CAGATCTTGTAGGGTCATGTGGG - Intergenic
1187245639 X:17550852-17550874 CAGATCACATAGGGTCTTGTGGG - Intronic
1187927560 X:24263896-24263918 CAGAGCATGTGGGACCTTGCAGG - Intergenic
1188232150 X:27677663-27677685 CAGGTCATGCAGGACCTTGCAGG + Intronic
1189145963 X:38655055-38655077 CAGGTCAAGTAGGACCTTGCAGG + Intronic
1189148199 X:38676695-38676717 CAGATCACATAGAATTTTGAAGG - Intronic
1189537986 X:41956206-41956228 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1190489342 X:50965394-50965416 CAGATCATGTAGGATTTTGTAGG - Intergenic
1190853077 X:54265553-54265575 CAGATCCTGTAGGACTTTGCAGG + Intronic
1191853700 X:65605624-65605646 TAGATCATGTAGGCTCTTTTGGG - Intronic
1192273832 X:69610180-69610202 CAGATCATGTAGGGCCTTGTAGG + Intergenic
1192280119 X:69676116-69676138 CAGATCATGTAGGGCTTTGTAGG + Intronic
1192340777 X:70261663-70261685 CAGATCATGAAGGTCCTTGGAGG + Intergenic
1192596001 X:72408850-72408872 CAGATCATGTAGGGTGTTGTAGG + Intronic
1193624707 X:83803842-83803864 TAGATCATGTAGGGCCTTGTAGG + Intergenic
1194034589 X:88854702-88854724 GAGATCATTTAGGAGCTTTAAGG + Intergenic
1194423601 X:93708314-93708336 CAGATCATATAGGACCTTATAGG + Intronic
1194713699 X:97265761-97265783 CAAATCATGTAGGTCCTTGTTGG + Intronic
1195209007 X:102633386-102633408 CAGATCATGTAAGATATTACAGG + Intergenic
1195408582 X:104544271-104544293 CAGATCATAAAGGACCTTGTGGG - Intergenic
1195959227 X:110368326-110368348 TAGATCATGTAGAATCTTGTAGG - Intronic
1196003794 X:110813914-110813936 CAGATCATGTAGGGCTTTGAAGG + Intergenic
1196141535 X:112268108-112268130 CAGATTAGGTAGGATCTTGAAGG - Intergenic
1196315639 X:114219737-114219759 CAGATCATGTAAGGTTTTTAAGG + Intergenic
1196728193 X:118915901-118915923 CAGATCATGAGGGATCTGTAGGG - Intergenic
1196764657 X:119231952-119231974 CAGATCCTGTAGGGCCTTGTAGG + Intergenic
1197088988 X:122513898-122513920 CATCTCATGTAGTATCTTGCAGG - Intergenic
1197741707 X:129900057-129900079 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1197793305 X:130277017-130277039 TAGACCAAGCAGGATCTTGAAGG + Intergenic
1197881749 X:131173841-131173863 CAGATCATGTAGGGCCTTTTAGG + Intergenic
1197918478 X:131561978-131562000 CAGATCATTTAGAGTCTTGTAGG + Intergenic
1198380840 X:136081973-136081995 CAGATCATGTAAGGCCTTGTAGG - Intergenic
1198448235 X:136739922-136739944 CAGATCCTGGAGGACCTTGGAGG + Intronic
1198464321 X:136890934-136890956 CAAATCATGTAGGTTCATGTAGG + Intergenic
1198710430 X:139495661-139495683 CAGATCATGGAGGTCCTTGTAGG - Intergenic
1198778558 X:140208263-140208285 CAGATCAGGTAGGGGCTTGTGGG + Intergenic
1198889142 X:141373560-141373582 CAGATCCTGCAGCATATTGAAGG + Intergenic
1198912894 X:141634026-141634048 GAGATCATGTTGGAACTTTAAGG + Intronic
1199119685 X:144036823-144036845 CAGATCATGTGTGATTTTCATGG + Intergenic
1199778274 X:151034728-151034750 CAGATCCTATAGGACCTTGTGGG - Intergenic
1199828807 X:151528316-151528338 CAGATCATGTAAGGTTTTGTAGG + Intergenic
1200303029 X:154997727-154997749 CATAACATGTAGGACCTTGCAGG + Intronic
1200935210 Y:8732453-8732475 CAGATCATTTTGGATCCTTAGGG + Intergenic
1202361636 Y:24116898-24116920 CAAATCATGTAGCAACTTGCTGG - Intergenic
1202363437 Y:24136198-24136220 CAAATCATGTAGCAACTTGCTGG + Intergenic
1202507343 Y:25533919-25533941 CAAATCATGTAGCAACTTGCTGG - Intergenic
1202509142 Y:25553215-25553237 CAAATCATGTAGCAACTTGCTGG + Intergenic