ID: 997453909

View in Genome Browser
Species Human (GRCh38)
Location 5:134004243-134004265
Sequence GGCGGCGAACGGGTCCCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 74}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997453900_997453909 3 Left 997453900 5:134004217-134004239 CCCGCTGGCCTGGTCCGGCGAGC 0: 1
1: 0
2: 1
3: 0
4: 90
Right 997453909 5:134004243-134004265 GGCGGCGAACGGGTCCCCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 74
997453898_997453909 7 Left 997453898 5:134004213-134004235 CCCGCCCGCTGGCCTGGTCCGGC 0: 1
1: 0
2: 0
3: 19
4: 209
Right 997453909 5:134004243-134004265 GGCGGCGAACGGGTCCCCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 74
997453904_997453909 -5 Left 997453904 5:134004225-134004247 CCTGGTCCGGCGAGCGTGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 997453909 5:134004243-134004265 GGCGGCGAACGGGTCCCCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 74
997453901_997453909 2 Left 997453901 5:134004218-134004240 CCGCTGGCCTGGTCCGGCGAGCG 0: 1
1: 0
2: 0
3: 1
4: 62
Right 997453909 5:134004243-134004265 GGCGGCGAACGGGTCCCCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 74
997453893_997453909 30 Left 997453893 5:134004190-134004212 CCGAGGCGGCAGCGTGGCCGGCA 0: 1
1: 0
2: 0
3: 12
4: 144
Right 997453909 5:134004243-134004265 GGCGGCGAACGGGTCCCCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 74
997453895_997453909 13 Left 997453895 5:134004207-134004229 CCGGCACCCGCCCGCTGGCCTGG 0: 1
1: 0
2: 3
3: 20
4: 389
Right 997453909 5:134004243-134004265 GGCGGCGAACGGGTCCCCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 74
997453899_997453909 6 Left 997453899 5:134004214-134004236 CCGCCCGCTGGCCTGGTCCGGCG 0: 1
1: 0
2: 0
3: 7
4: 127
Right 997453909 5:134004243-134004265 GGCGGCGAACGGGTCCCCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997453909 Original CRISPR GGCGGCGAACGGGTCCCCGC CGG Intronic
900109415 1:999259-999281 GGCGGCGGGAGGGTCCCAGCTGG + Exonic
900283914 1:1890502-1890524 GGCGGCGGCCGGGGCCCCGGGGG - Intronic
901836280 1:11926058-11926080 GGCGGCGCCCGGCTCACCGCGGG + Exonic
901886969 1:12230174-12230196 GGCGGCCCGCGGGTCCGCGCCGG - Intronic
910408498 1:86914978-86915000 GGCGGGGAGCGGGACCCCGGAGG - Exonic
916108644 1:161447911-161447933 GGCGCCGGCCGTGTCCCCGCCGG - Intergenic
916110232 1:161455292-161455314 GGCGCCGGCCGTGTCCCCGCCGG - Intergenic
916111817 1:161462702-161462724 GGCGCCGGCCGTGTCCCCGCCGG - Intergenic
916113404 1:161470083-161470105 GGCGCCGGCCGTGTCCCCGCCGG - Intergenic
918064261 1:181089080-181089102 GGCGGCGCCGGGGTCCCAGCGGG - Exonic
921850428 1:219927987-219928009 GGCGGCGACTGCGTCCCCGGAGG + Exonic
922440738 1:225653275-225653297 GCCGGCGGCCGGGCCCCCGCCGG + Intergenic
1064209000 10:13347873-13347895 GGCGGCGCGCGGCTCCCCGGCGG + Intronic
1065299839 10:24311347-24311369 GGTGGTGAACGGGTCCTCGCTGG + Intronic
1070964015 10:80518464-80518486 GGAGGCGGACGTGGCCCCGCTGG + Exonic
1072409089 10:95183932-95183954 GGCGGCGGCCGGGGCCCCACGGG - Intergenic
1076120871 10:127935567-127935589 GGAGATGAAAGGGTCCCCGCGGG - Intronic
1076146474 10:128126243-128126265 TGCAGCGAACGCGACCCCGCGGG - Exonic
1083171098 11:60924517-60924539 GGCGGCGGCCGGGACCCAGCGGG + Exonic
1097787785 12:63780062-63780084 GGCGCCGGCCGGGTCCCCGCGGG + Exonic
1102157536 12:110742926-110742948 GGCGGCGCACGGATGCGCGCGGG + Exonic
1113254837 13:108495674-108495696 GGCGGCGACACAGTCCCCGCCGG - Intergenic
1117176668 14:53152943-53152965 GCCGTCGTCCGGGTCCCCGCCGG + Exonic
1118797169 14:69153504-69153526 GCCGGCCCGCGGGTCCCCGCGGG - Intergenic
1124129469 15:26971458-26971480 GGCGGAGACCAGGTCCGCGCCGG + Exonic
1127770119 15:62224247-62224269 GGCGGCGCCAGGGGCCCCGCTGG + Intergenic
1128425891 15:67542446-67542468 GGCCGTGACCGGGTCGCCGCGGG + Intergenic
1129162095 15:73752806-73752828 CGCGGGGACCCGGTCCCCGCCGG + Intergenic
1132609875 16:810330-810352 GGTGAGGAACGGGTCCCCTCTGG + Intronic
1142206387 16:88785057-88785079 GGCGGCGCGCGGGTCCCCGCGGG - Exonic
1146353141 17:32112643-32112665 GCCGGCGATCTGGTCCCCTCGGG + Intergenic
1146492575 17:33292904-33292926 GGCGGCGAACAGCCTCCCGCAGG - Exonic
1147159456 17:38561903-38561925 GTAGGCGAACGGGTCGCCGGCGG + Exonic
1147970869 17:44218775-44218797 CGCTGCGTCCGGGTCCCCGCCGG - Intronic
1148356443 17:46978847-46978869 GCCAGCGACGGGGTCCCCGCGGG - Exonic
1151767558 17:76140170-76140192 AGCGGCGCCCGGGTCCCCCCTGG - Exonic
1153855089 18:9137210-9137232 GGCGGCGGGCGGGGCCCCGGCGG - Intronic
1155054368 18:22171289-22171311 GGCGGAGAGCGGGGCCCCGGCGG + Exonic
1155972267 18:32093011-32093033 GGCGGGGAACGGGACCTCGCGGG - Intronic
1160499345 18:79394542-79394564 GGCGCCGTAGGGGCCCCCGCAGG + Intergenic
1160869278 19:1269605-1269627 GGCGGCAACCGGGTCGCCGGCGG - Intronic
1161581307 19:5082518-5082540 TGCTGGGAACGGGTCCCAGCAGG + Intronic
1163609036 19:18291752-18291774 GGCGGCGGAGAGGACCCCGCAGG - Intergenic
1163743829 19:19033296-19033318 GGCGGCGGCCGCGTCCCCGCCGG - Intronic
1167358937 19:49019707-49019729 CGGGGCGCGCGGGTCCCCGCTGG + Intergenic
932209588 2:69915612-69915634 GGCGGCGTTCGGGACCCCGGCGG - Intronic
937047286 2:118858585-118858607 GGCGGGGAACGCGGCCCCACTGG - Intergenic
1171427381 20:25057522-25057544 AGCGGCCGCCGGGTCCCCGCGGG + Intronic
1172028959 20:31968277-31968299 GGCGGCGGCCGGGCCCCCGGGGG + Exonic
1172354325 20:34269085-34269107 GGAGGCGCACGGGTCGCAGCAGG - Exonic
1174487592 20:50871041-50871063 GGCTGGGAATGAGTCCCCGCTGG - Intronic
1183437075 22:37802523-37802545 GGCGGCTCTCGGGTCCCCACCGG - Intergenic
1184663370 22:45975752-45975774 GGCGGGGCCCGGGTCCCCGCAGG + Intronic
1184741223 22:46430043-46430065 GGTGGGGGAAGGGTCCCCGCAGG + Intronic
1185148110 22:49150143-49150165 GGAGGCGAACGGGACCCCACTGG + Intergenic
950215246 3:11154375-11154397 GGCGGGGACCCGGGCCCCGCGGG - Intronic
963939710 3:151086353-151086375 GGCGGGGGAAGGGTCCCTGCCGG + Intronic
968674908 4:1871859-1871881 GGCGGCTAACGGGGCCGGGCGGG + Intronic
969715893 4:8867917-8867939 GGCGGCCAGCCTGTCCCCGCCGG - Exonic
970698545 4:18707993-18708015 GGGGGCGAACTGGTCCGCTCAGG + Intergenic
975633084 4:76421278-76421300 GGCGCGGGAGGGGTCCCCGCCGG - Intronic
976246534 4:83010977-83010999 GGCGGAGCACGGGCCCCCGCAGG + Intronic
979231400 4:118352542-118352564 GGCGGCGGACGCGTCCTCGGGGG + Exonic
985699281 5:1360932-1360954 GGTGGCCAAGGGGTCCCTGCAGG + Intergenic
985896098 5:2750933-2750955 GGGGGCGCGCGGGTCCCGGCCGG + Intronic
997453909 5:134004243-134004265 GGCGGCGAACGGGTCCCCGCCGG + Intronic
998407684 5:141883224-141883246 GGCGGCCACCGGGTCCCCGGGGG - Intergenic
1003645525 6:7910623-7910645 GGCGGCGGACGGGCCCCCCGCGG - Exonic
1013793678 6:113860413-113860435 GGCGGCGGAGGGGGCCTCGCAGG - Exonic
1016597104 6:145814868-145814890 GGCGGCGTGCGCGTCCCCGCCGG - Intergenic
1018400301 6:163414544-163414566 GGCGGCGGGCGGGGCCGCGCAGG - Intronic
1031134809 7:117873262-117873284 GGCGGCGCCGGGGTCCCAGCCGG - Intronic
1045488739 8:102654513-102654535 GGCGGCGGCCGGGTTTCCGCGGG - Intronic
1045583304 8:103501133-103501155 GGCGGCGAACTGGGGCGCGCAGG - Intronic
1049178156 8:141206535-141206557 GGCGTGGAAGGGGTCCCAGCAGG - Intergenic
1058149612 9:101449512-101449534 GGCGGCGCACGGGTACCTGGTGG + Intergenic
1060849197 9:126860687-126860709 GGCGGCGGAGGGGGCGCCGCGGG + Intronic
1061133594 9:128721436-128721458 GGTGGCGAACAGGAGCCCGCTGG + Exonic
1061208343 9:129177054-129177076 GGGGGCGAACGGGGCGCCCCCGG + Exonic
1061666417 9:132163001-132163023 GGCGGCGGCCGGGTCGCCACAGG + Intronic
1061893485 9:133634932-133634954 GGGGGCGAACGGTGCCCCTCTGG + Intergenic
1061996911 9:134190789-134190811 GGCTGAGCACGGGTCCCGGCAGG + Intergenic
1196684085 X:118495943-118495965 GGCGGCGGGCGGGTCTCGGCGGG - Exonic
1196791619 X:119469239-119469261 GGCGGCGCTCGGGTCACCTCTGG + Intronic
1198807112 X:140503819-140503841 GGCGTCGGCCGCGTCCCCGCCGG + Exonic