ID: 997456974

View in Genome Browser
Species Human (GRCh38)
Location 5:134024941-134024963
Sequence GCTGGGAGCTTGGCCAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997456974_997456983 18 Left 997456974 5:134024941-134024963 CCAGCCCTGGCCAAGCTCCCAGC No data
Right 997456983 5:134024982-134025004 TGGCCCCAGCCAACACCACATGG No data
997456974_997456988 28 Left 997456974 5:134024941-134024963 CCAGCCCTGGCCAAGCTCCCAGC No data
Right 997456988 5:134024992-134025014 CAACACCACATGGAGCAGCATGG No data
997456974_997456981 -2 Left 997456974 5:134024941-134024963 CCAGCCCTGGCCAAGCTCCCAGC No data
Right 997456981 5:134024962-134024984 GCTGAAGGCAGCCACATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997456974 Original CRISPR GCTGGGAGCTTGGCCAGGGC TGG (reversed) Intergenic