ID: 997456978

View in Genome Browser
Species Human (GRCh38)
Location 5:134024951-134024973
Sequence GCTGCCTTCAGCTGGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997456978_997456988 18 Left 997456978 5:134024951-134024973 CCAAGCTCCCAGCTGAAGGCAGC No data
Right 997456988 5:134024992-134025014 CAACACCACATGGAGCAGCATGG No data
997456978_997456983 8 Left 997456978 5:134024951-134024973 CCAAGCTCCCAGCTGAAGGCAGC No data
Right 997456983 5:134024982-134025004 TGGCCCCAGCCAACACCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997456978 Original CRISPR GCTGCCTTCAGCTGGGAGCT TGG (reversed) Intergenic