ID: 997456979

View in Genome Browser
Species Human (GRCh38)
Location 5:134024958-134024980
Sequence GCATGTGGCTGCCTTCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997456979_997456988 11 Left 997456979 5:134024958-134024980 CCCAGCTGAAGGCAGCCACATGC No data
Right 997456988 5:134024992-134025014 CAACACCACATGGAGCAGCATGG No data
997456979_997456983 1 Left 997456979 5:134024958-134024980 CCCAGCTGAAGGCAGCCACATGC No data
Right 997456983 5:134024982-134025004 TGGCCCCAGCCAACACCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997456979 Original CRISPR GCATGTGGCTGCCTTCAGCT GGG (reversed) Intergenic