ID: 997456981

View in Genome Browser
Species Human (GRCh38)
Location 5:134024962-134024984
Sequence GCTGAAGGCAGCCACATGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997456974_997456981 -2 Left 997456974 5:134024941-134024963 CCAGCCCTGGCCAAGCTCCCAGC No data
Right 997456981 5:134024962-134024984 GCTGAAGGCAGCCACATGCATGG No data
997456971_997456981 30 Left 997456971 5:134024909-134024931 CCATACACGTGAGTGAAGCCATC No data
Right 997456981 5:134024962-134024984 GCTGAAGGCAGCCACATGCATGG No data
997456975_997456981 -6 Left 997456975 5:134024945-134024967 CCCTGGCCAAGCTCCCAGCTGAA No data
Right 997456981 5:134024962-134024984 GCTGAAGGCAGCCACATGCATGG No data
997456976_997456981 -7 Left 997456976 5:134024946-134024968 CCTGGCCAAGCTCCCAGCTGAAG No data
Right 997456981 5:134024962-134024984 GCTGAAGGCAGCCACATGCATGG No data
997456972_997456981 12 Left 997456972 5:134024927-134024949 CCATCTAGAAGATTCCAGCCCTG No data
Right 997456981 5:134024962-134024984 GCTGAAGGCAGCCACATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997456981 Original CRISPR GCTGAAGGCAGCCACATGCA TGG Intergenic