ID: 997456982

View in Genome Browser
Species Human (GRCh38)
Location 5:134024973-134024995
Sequence GTTGGCTGGGGCCATGCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997456982_997456993 29 Left 997456982 5:134024973-134024995 CCACATGCATGGCCCCAGCCAAC No data
Right 997456993 5:134025025-134025047 CCACTGCCCTGTCCCAGGCGTGG No data
997456982_997456994 30 Left 997456982 5:134024973-134024995 CCACATGCATGGCCCCAGCCAAC No data
Right 997456994 5:134025026-134025048 CACTGCCCTGTCCCAGGCGTGGG No data
997456982_997456988 -4 Left 997456982 5:134024973-134024995 CCACATGCATGGCCCCAGCCAAC No data
Right 997456988 5:134024992-134025014 CAACACCACATGGAGCAGCATGG No data
997456982_997456991 24 Left 997456982 5:134024973-134024995 CCACATGCATGGCCCCAGCCAAC No data
Right 997456991 5:134025020-134025042 CCAAGCCACTGCCCTGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997456982 Original CRISPR GTTGGCTGGGGCCATGCATG TGG (reversed) Intergenic