ID: 997456985

View in Genome Browser
Species Human (GRCh38)
Location 5:134024986-134025008
Sequence TGCTCCATGTGGTGTTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997456985_997456997 23 Left 997456985 5:134024986-134025008 CCCAGCCAACACCACATGGAGCA No data
Right 997456997 5:134025032-134025054 CCTGTCCCAGGCGTGGGATGAGG No data
997456985_997456994 17 Left 997456985 5:134024986-134025008 CCCAGCCAACACCACATGGAGCA No data
Right 997456994 5:134025026-134025048 CACTGCCCTGTCCCAGGCGTGGG No data
997456985_997456998 24 Left 997456985 5:134024986-134025008 CCCAGCCAACACCACATGGAGCA No data
Right 997456998 5:134025033-134025055 CTGTCCCAGGCGTGGGATGAGGG No data
997456985_997456991 11 Left 997456985 5:134024986-134025008 CCCAGCCAACACCACATGGAGCA No data
Right 997456991 5:134025020-134025042 CCAAGCCACTGCCCTGTCCCAGG No data
997456985_997456993 16 Left 997456985 5:134024986-134025008 CCCAGCCAACACCACATGGAGCA No data
Right 997456993 5:134025025-134025047 CCACTGCCCTGTCCCAGGCGTGG No data
997456985_997456999 27 Left 997456985 5:134024986-134025008 CCCAGCCAACACCACATGGAGCA No data
Right 997456999 5:134025036-134025058 TCCCAGGCGTGGGATGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997456985 Original CRISPR TGCTCCATGTGGTGTTGGCT GGG (reversed) Intergenic