ID: 997456986

View in Genome Browser
Species Human (GRCh38)
Location 5:134024987-134025009
Sequence CTGCTCCATGTGGTGTTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997456986_997456999 26 Left 997456986 5:134024987-134025009 CCAGCCAACACCACATGGAGCAG No data
Right 997456999 5:134025036-134025058 TCCCAGGCGTGGGATGAGGGAGG No data
997456986_997456994 16 Left 997456986 5:134024987-134025009 CCAGCCAACACCACATGGAGCAG No data
Right 997456994 5:134025026-134025048 CACTGCCCTGTCCCAGGCGTGGG No data
997456986_997456997 22 Left 997456986 5:134024987-134025009 CCAGCCAACACCACATGGAGCAG No data
Right 997456997 5:134025032-134025054 CCTGTCCCAGGCGTGGGATGAGG No data
997456986_997456991 10 Left 997456986 5:134024987-134025009 CCAGCCAACACCACATGGAGCAG No data
Right 997456991 5:134025020-134025042 CCAAGCCACTGCCCTGTCCCAGG No data
997456986_997456993 15 Left 997456986 5:134024987-134025009 CCAGCCAACACCACATGGAGCAG No data
Right 997456993 5:134025025-134025047 CCACTGCCCTGTCCCAGGCGTGG No data
997456986_997456998 23 Left 997456986 5:134024987-134025009 CCAGCCAACACCACATGGAGCAG No data
Right 997456998 5:134025033-134025055 CTGTCCCAGGCGTGGGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997456986 Original CRISPR CTGCTCCATGTGGTGTTGGC TGG (reversed) Intergenic