ID: 997456988

View in Genome Browser
Species Human (GRCh38)
Location 5:134024992-134025014
Sequence CAACACCACATGGAGCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997456974_997456988 28 Left 997456974 5:134024941-134024963 CCAGCCCTGGCCAAGCTCCCAGC No data
Right 997456988 5:134024992-134025014 CAACACCACATGGAGCAGCATGG No data
997456979_997456988 11 Left 997456979 5:134024958-134024980 CCCAGCTGAAGGCAGCCACATGC No data
Right 997456988 5:134024992-134025014 CAACACCACATGGAGCAGCATGG No data
997456978_997456988 18 Left 997456978 5:134024951-134024973 CCAAGCTCCCAGCTGAAGGCAGC No data
Right 997456988 5:134024992-134025014 CAACACCACATGGAGCAGCATGG No data
997456982_997456988 -4 Left 997456982 5:134024973-134024995 CCACATGCATGGCCCCAGCCAAC No data
Right 997456988 5:134024992-134025014 CAACACCACATGGAGCAGCATGG No data
997456976_997456988 23 Left 997456976 5:134024946-134024968 CCTGGCCAAGCTCCCAGCTGAAG No data
Right 997456988 5:134024992-134025014 CAACACCACATGGAGCAGCATGG No data
997456980_997456988 10 Left 997456980 5:134024959-134024981 CCAGCTGAAGGCAGCCACATGCA No data
Right 997456988 5:134024992-134025014 CAACACCACATGGAGCAGCATGG No data
997456975_997456988 24 Left 997456975 5:134024945-134024967 CCCTGGCCAAGCTCCCAGCTGAA No data
Right 997456988 5:134024992-134025014 CAACACCACATGGAGCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997456988 Original CRISPR CAACACCACATGGAGCAGCA TGG Intergenic