ID: 997456990

View in Genome Browser
Species Human (GRCh38)
Location 5:134025020-134025042
Sequence CCTGGGACAGGGCAGTGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997456990_997456999 -7 Left 997456990 5:134025020-134025042 CCAAGCCACTGCCCTGTCCCAGG No data
Right 997456999 5:134025036-134025058 TCCCAGGCGTGGGATGAGGGAGG No data
997456990_997456998 -10 Left 997456990 5:134025020-134025042 CCAAGCCACTGCCCTGTCCCAGG No data
Right 997456998 5:134025033-134025055 CTGTCCCAGGCGTGGGATGAGGG No data
997456990_997457002 12 Left 997456990 5:134025020-134025042 CCAAGCCACTGCCCTGTCCCAGG No data
Right 997457002 5:134025055-134025077 GAGGCTGTGTTAGTCCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997456990 Original CRISPR CCTGGGACAGGGCAGTGGCT TGG (reversed) Intergenic