ID: 997456993

View in Genome Browser
Species Human (GRCh38)
Location 5:134025025-134025047
Sequence CCACTGCCCTGTCCCAGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997456989_997456993 5 Left 997456989 5:134024997-134025019 CCACATGGAGCAGCATGGTGAAG No data
Right 997456993 5:134025025-134025047 CCACTGCCCTGTCCCAGGCGTGG No data
997456986_997456993 15 Left 997456986 5:134024987-134025009 CCAGCCAACACCACATGGAGCAG No data
Right 997456993 5:134025025-134025047 CCACTGCCCTGTCCCAGGCGTGG No data
997456987_997456993 11 Left 997456987 5:134024991-134025013 CCAACACCACATGGAGCAGCATG No data
Right 997456993 5:134025025-134025047 CCACTGCCCTGTCCCAGGCGTGG No data
997456984_997456993 17 Left 997456984 5:134024985-134025007 CCCCAGCCAACACCACATGGAGC No data
Right 997456993 5:134025025-134025047 CCACTGCCCTGTCCCAGGCGTGG No data
997456982_997456993 29 Left 997456982 5:134024973-134024995 CCACATGCATGGCCCCAGCCAAC No data
Right 997456993 5:134025025-134025047 CCACTGCCCTGTCCCAGGCGTGG No data
997456985_997456993 16 Left 997456985 5:134024986-134025008 CCCAGCCAACACCACATGGAGCA No data
Right 997456993 5:134025025-134025047 CCACTGCCCTGTCCCAGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997456993 Original CRISPR CCACTGCCCTGTCCCAGGCG TGG Intergenic