ID: 997456998

View in Genome Browser
Species Human (GRCh38)
Location 5:134025033-134025055
Sequence CTGTCCCAGGCGTGGGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997456986_997456998 23 Left 997456986 5:134024987-134025009 CCAGCCAACACCACATGGAGCAG No data
Right 997456998 5:134025033-134025055 CTGTCCCAGGCGTGGGATGAGGG No data
997456985_997456998 24 Left 997456985 5:134024986-134025008 CCCAGCCAACACCACATGGAGCA No data
Right 997456998 5:134025033-134025055 CTGTCCCAGGCGTGGGATGAGGG No data
997456987_997456998 19 Left 997456987 5:134024991-134025013 CCAACACCACATGGAGCAGCATG No data
Right 997456998 5:134025033-134025055 CTGTCCCAGGCGTGGGATGAGGG No data
997456989_997456998 13 Left 997456989 5:134024997-134025019 CCACATGGAGCAGCATGGTGAAG No data
Right 997456998 5:134025033-134025055 CTGTCCCAGGCGTGGGATGAGGG No data
997456984_997456998 25 Left 997456984 5:134024985-134025007 CCCCAGCCAACACCACATGGAGC No data
Right 997456998 5:134025033-134025055 CTGTCCCAGGCGTGGGATGAGGG No data
997456990_997456998 -10 Left 997456990 5:134025020-134025042 CCAAGCCACTGCCCTGTCCCAGG No data
Right 997456998 5:134025033-134025055 CTGTCCCAGGCGTGGGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997456998 Original CRISPR CTGTCCCAGGCGTGGGATGA GGG Intergenic