ID: 997457002

View in Genome Browser
Species Human (GRCh38)
Location 5:134025055-134025077
Sequence GAGGCTGTGTTAGTCCATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997457001_997457002 -6 Left 997457001 5:134025038-134025060 CCAGGCGTGGGATGAGGGAGGCT No data
Right 997457002 5:134025055-134025077 GAGGCTGTGTTAGTCCATTTTGG No data
997456995_997457002 1 Left 997456995 5:134025031-134025053 CCCTGTCCCAGGCGTGGGATGAG No data
Right 997457002 5:134025055-134025077 GAGGCTGTGTTAGTCCATTTTGG No data
997456996_997457002 0 Left 997456996 5:134025032-134025054 CCTGTCCCAGGCGTGGGATGAGG No data
Right 997457002 5:134025055-134025077 GAGGCTGTGTTAGTCCATTTTGG No data
997457000_997457002 -5 Left 997457000 5:134025037-134025059 CCCAGGCGTGGGATGAGGGAGGC No data
Right 997457002 5:134025055-134025077 GAGGCTGTGTTAGTCCATTTTGG No data
997456992_997457002 7 Left 997456992 5:134025025-134025047 CCACTGCCCTGTCCCAGGCGTGG No data
Right 997457002 5:134025055-134025077 GAGGCTGTGTTAGTCCATTTTGG No data
997456990_997457002 12 Left 997456990 5:134025020-134025042 CCAAGCCACTGCCCTGTCCCAGG No data
Right 997457002 5:134025055-134025077 GAGGCTGTGTTAGTCCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997457002 Original CRISPR GAGGCTGTGTTAGTCCATTT TGG Intergenic