ID: 997459269

View in Genome Browser
Species Human (GRCh38)
Location 5:134041354-134041376
Sequence TCCATGGATGTGCCCCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997459269_997459278 24 Left 997459269 5:134041354-134041376 CCCAGGAGGGGCACATCCATGGA No data
Right 997459278 5:134041401-134041423 GCCTCTGCTGACCAGTGGGAAGG No data
997459269_997459274 2 Left 997459269 5:134041354-134041376 CCCAGGAGGGGCACATCCATGGA No data
Right 997459274 5:134041379-134041401 ATGTAAACCAAGCAGTGTAGGGG No data
997459269_997459272 0 Left 997459269 5:134041354-134041376 CCCAGGAGGGGCACATCCATGGA No data
Right 997459272 5:134041377-134041399 TCATGTAAACCAAGCAGTGTAGG No data
997459269_997459276 19 Left 997459269 5:134041354-134041376 CCCAGGAGGGGCACATCCATGGA No data
Right 997459276 5:134041396-134041418 TAGGGGCCTCTGCTGACCAGTGG No data
997459269_997459277 20 Left 997459269 5:134041354-134041376 CCCAGGAGGGGCACATCCATGGA No data
Right 997459277 5:134041397-134041419 AGGGGCCTCTGCTGACCAGTGGG No data
997459269_997459273 1 Left 997459269 5:134041354-134041376 CCCAGGAGGGGCACATCCATGGA No data
Right 997459273 5:134041378-134041400 CATGTAAACCAAGCAGTGTAGGG No data
997459269_997459280 30 Left 997459269 5:134041354-134041376 CCCAGGAGGGGCACATCCATGGA No data
Right 997459280 5:134041407-134041429 GCTGACCAGTGGGAAGGCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997459269 Original CRISPR TCCATGGATGTGCCCCTCCT GGG (reversed) Intergenic
No off target data available for this crispr