ID: 997460341

View in Genome Browser
Species Human (GRCh38)
Location 5:134047500-134047522
Sequence GAGTCCCTGGGGTCTGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997460341_997460351 13 Left 997460341 5:134047500-134047522 CCAACTCCAGACCCCAGGGACTC No data
Right 997460351 5:134047536-134047558 CAGAAGGAAACTGGCAGCAGAGG No data
997460341_997460355 30 Left 997460341 5:134047500-134047522 CCAACTCCAGACCCCAGGGACTC No data
Right 997460355 5:134047553-134047575 CAGAGGCTGCAGGGCCTCCTGGG No data
997460341_997460346 -3 Left 997460341 5:134047500-134047522 CCAACTCCAGACCCCAGGGACTC No data
Right 997460346 5:134047520-134047542 CTCCATTCATCCCGCACAGAAGG No data
997460341_997460353 21 Left 997460341 5:134047500-134047522 CCAACTCCAGACCCCAGGGACTC No data
Right 997460353 5:134047544-134047566 AACTGGCAGCAGAGGCTGCAGGG No data
997460341_997460354 29 Left 997460341 5:134047500-134047522 CCAACTCCAGACCCCAGGGACTC No data
Right 997460354 5:134047552-134047574 GCAGAGGCTGCAGGGCCTCCTGG No data
997460341_997460348 4 Left 997460341 5:134047500-134047522 CCAACTCCAGACCCCAGGGACTC No data
Right 997460348 5:134047527-134047549 CATCCCGCACAGAAGGAAACTGG No data
997460341_997460352 20 Left 997460341 5:134047500-134047522 CCAACTCCAGACCCCAGGGACTC No data
Right 997460352 5:134047543-134047565 AAACTGGCAGCAGAGGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997460341 Original CRISPR GAGTCCCTGGGGTCTGGAGT TGG (reversed) Intergenic
No off target data available for this crispr