ID: 997461159

View in Genome Browser
Species Human (GRCh38)
Location 5:134053435-134053457
Sequence GAGCCCTAGACAATGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997461159_997461163 -5 Left 997461159 5:134053435-134053457 CCCTCCATCATTGTCTAGGGCTC No data
Right 997461163 5:134053453-134053475 GGCTCCTGTGAGCCGTGCCAGGG No data
997461159_997461168 7 Left 997461159 5:134053435-134053457 CCCTCCATCATTGTCTAGGGCTC No data
Right 997461168 5:134053465-134053487 CCGTGCCAGGGGCAGGCGCCAGG No data
997461159_997461172 24 Left 997461159 5:134053435-134053457 CCCTCCATCATTGTCTAGGGCTC No data
Right 997461172 5:134053482-134053504 GCCAGGAAGGAGGATCCTGCAGG No data
997461159_997461169 11 Left 997461159 5:134053435-134053457 CCCTCCATCATTGTCTAGGGCTC No data
Right 997461169 5:134053469-134053491 GCCAGGGGCAGGCGCCAGGAAGG No data
997461159_997461174 27 Left 997461159 5:134053435-134053457 CCCTCCATCATTGTCTAGGGCTC No data
Right 997461174 5:134053485-134053507 AGGAAGGAGGATCCTGCAGGAGG No data
997461159_997461171 14 Left 997461159 5:134053435-134053457 CCCTCCATCATTGTCTAGGGCTC No data
Right 997461171 5:134053472-134053494 AGGGGCAGGCGCCAGGAAGGAGG No data
997461159_997461164 -4 Left 997461159 5:134053435-134053457 CCCTCCATCATTGTCTAGGGCTC No data
Right 997461164 5:134053454-134053476 GCTCCTGTGAGCCGTGCCAGGGG No data
997461159_997461162 -6 Left 997461159 5:134053435-134053457 CCCTCCATCATTGTCTAGGGCTC No data
Right 997461162 5:134053452-134053474 GGGCTCCTGTGAGCCGTGCCAGG No data
997461159_997461166 0 Left 997461159 5:134053435-134053457 CCCTCCATCATTGTCTAGGGCTC No data
Right 997461166 5:134053458-134053480 CTGTGAGCCGTGCCAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997461159 Original CRISPR GAGCCCTAGACAATGATGGA GGG (reversed) Intergenic
No off target data available for this crispr