ID: 997462088

View in Genome Browser
Species Human (GRCh38)
Location 5:134059589-134059611
Sequence GCTGATGCTCAGAGGCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997462088_997462098 19 Left 997462088 5:134059589-134059611 CCCACAGGCCTCTGAGCATCAGC No data
Right 997462098 5:134059631-134059653 GCATCCTTGTCCATGACAACAGG No data
997462088_997462099 20 Left 997462088 5:134059589-134059611 CCCACAGGCCTCTGAGCATCAGC No data
Right 997462099 5:134059632-134059654 CATCCTTGTCCATGACAACAGGG No data
997462088_997462091 -4 Left 997462088 5:134059589-134059611 CCCACAGGCCTCTGAGCATCAGC No data
Right 997462091 5:134059608-134059630 CAGCACACCCCCGAGCCATTTGG No data
997462088_997462092 -3 Left 997462088 5:134059589-134059611 CCCACAGGCCTCTGAGCATCAGC No data
Right 997462092 5:134059609-134059631 AGCACACCCCCGAGCCATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997462088 Original CRISPR GCTGATGCTCAGAGGCCTGT GGG (reversed) Intergenic
No off target data available for this crispr