ID: 997463262

View in Genome Browser
Species Human (GRCh38)
Location 5:134070093-134070115
Sequence CAGACAGAGCAGAGGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997463262_997463269 28 Left 997463262 5:134070093-134070115 CCAGCAGCCCTCTGCTCTGTCTG No data
Right 997463269 5:134070144-134070166 TTTCTTATTTTTTTTGGAGGTGG No data
997463262_997463267 22 Left 997463262 5:134070093-134070115 CCAGCAGCCCTCTGCTCTGTCTG No data
Right 997463267 5:134070138-134070160 CTTTACTTTCTTATTTTTTTTGG No data
997463262_997463268 25 Left 997463262 5:134070093-134070115 CCAGCAGCCCTCTGCTCTGTCTG No data
Right 997463268 5:134070141-134070163 TACTTTCTTATTTTTTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997463262 Original CRISPR CAGACAGAGCAGAGGGCTGC TGG (reversed) Intergenic
No off target data available for this crispr