ID: 997464484

View in Genome Browser
Species Human (GRCh38)
Location 5:134078250-134078272
Sequence CTGCACACACAGACAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997464474_997464484 29 Left 997464474 5:134078198-134078220 CCTGCCCTCAAAGAGGCTAGAGA No data
Right 997464484 5:134078250-134078272 CTGCACACACAGACAGAGGAGGG No data
997464473_997464484 30 Left 997464473 5:134078197-134078219 CCCTGCCCTCAAAGAGGCTAGAG No data
Right 997464484 5:134078250-134078272 CTGCACACACAGACAGAGGAGGG No data
997464476_997464484 24 Left 997464476 5:134078203-134078225 CCTCAAAGAGGCTAGAGATGCCC No data
Right 997464484 5:134078250-134078272 CTGCACACACAGACAGAGGAGGG No data
997464480_997464484 4 Left 997464480 5:134078223-134078245 CCCGTGGGAGGTGCATGCAAAAC No data
Right 997464484 5:134078250-134078272 CTGCACACACAGACAGAGGAGGG No data
997464475_997464484 25 Left 997464475 5:134078202-134078224 CCCTCAAAGAGGCTAGAGATGCC No data
Right 997464484 5:134078250-134078272 CTGCACACACAGACAGAGGAGGG No data
997464481_997464484 3 Left 997464481 5:134078224-134078246 CCGTGGGAGGTGCATGCAAAACT No data
Right 997464484 5:134078250-134078272 CTGCACACACAGACAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997464484 Original CRISPR CTGCACACACAGACAGAGGA GGG Intergenic
No off target data available for this crispr