ID: 997468195

View in Genome Browser
Species Human (GRCh38)
Location 5:134102145-134102167
Sequence CTGGTGGCTGGATTTGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997468195_997468210 11 Left 997468195 5:134102145-134102167 CCCCTTCCAAATCCAGCCACCAG No data
Right 997468210 5:134102179-134102201 GAGCAGCCCCCGCCGCTCTGGGG No data
997468195_997468211 12 Left 997468195 5:134102145-134102167 CCCCTTCCAAATCCAGCCACCAG No data
Right 997468211 5:134102180-134102202 AGCAGCCCCCGCCGCTCTGGGGG No data
997468195_997468212 13 Left 997468195 5:134102145-134102167 CCCCTTCCAAATCCAGCCACCAG No data
Right 997468212 5:134102181-134102203 GCAGCCCCCGCCGCTCTGGGGGG No data
997468195_997468217 20 Left 997468195 5:134102145-134102167 CCCCTTCCAAATCCAGCCACCAG No data
Right 997468217 5:134102188-134102210 CCGCCGCTCTGGGGGGACTCTGG No data
997468195_997468208 9 Left 997468195 5:134102145-134102167 CCCCTTCCAAATCCAGCCACCAG No data
Right 997468208 5:134102177-134102199 GTGAGCAGCCCCCGCCGCTCTGG No data
997468195_997468218 21 Left 997468195 5:134102145-134102167 CCCCTTCCAAATCCAGCCACCAG No data
Right 997468218 5:134102189-134102211 CGCCGCTCTGGGGGGACTCTGGG No data
997468195_997468209 10 Left 997468195 5:134102145-134102167 CCCCTTCCAAATCCAGCCACCAG No data
Right 997468209 5:134102178-134102200 TGAGCAGCCCCCGCCGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997468195 Original CRISPR CTGGTGGCTGGATTTGGAAG GGG (reversed) Intergenic